Transcript: Mouse NM_001311135.1

Mus musculus ring finger protein 7 (Rnf7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rnf7 (19823)
Length:
1225
CDS:
94..366

Additional Resources:

NCBI RefSeq record:
NM_001311135.1
NBCI Gene record:
Rnf7 (19823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239805 AGGCGTAACTGTCGGGTAAAC pLKO_005 909 3UTR 100% 10.800 15.120 N LOC639931 n/a
2 TRCN0000239802 TAGTCCAAAGAATCGGCAAAT pLKO_005 406 3UTR 100% 10.800 15.120 N LOC639931 n/a
3 TRCN0000307362 GACGTTGAGTGCGATACCTGT pLKO_005 223 CDS 100% 2.640 3.696 N Rnf7 n/a
4 TRCN0000243749 TCAAGAAGTGGAACGCGGTAG pLKO_005 188 CDS 100% 2.250 3.150 N LOC632465 n/a
5 TRCN0000012873 GCCTGGATTGTTCAACCACTT pLKO.1 1000 3UTR 100% 4.050 3.240 N Rnf7 n/a
6 TRCN0000012876 GTAGTCCAAAGAATCGGCAAA pLKO.1 405 3UTR 100% 4.050 3.240 N Rnf7 n/a
7 TRCN0000239946 TGGGAAATTCTCTACAATTAA pLKO_005 573 3UTR 100% 15.000 10.500 N Gm7075 n/a
8 TRCN0000294582 TGACCCTGGACAAAGACTAAA pLKO_005 460 3UTR 100% 13.200 9.240 N Rnf7 n/a
9 TRCN0000307365 ATGTCCCTGTGGGTGAAACAG pLKO_005 351 CDS 100% 4.950 3.465 N Rnf7 n/a
10 TRCN0000243752 CAAGATGTTCTCTCTCAAGAA pLKO_005 174 CDS 100% 4.950 3.465 N LOC632465 n/a
11 TRCN0000239948 CATGTCCCTGTGGGTGAAACA pLKO_005 350 CDS 100% 4.950 3.465 N Gm7075 n/a
12 TRCN0000038806 CCTGTGGGTGAAACAGAACAA pLKO.1 356 CDS 100% 4.950 3.465 N RNF7 n/a
13 TRCN0000298777 CCTGTGGGTGAAACAGAACAA pLKO_005 356 CDS 100% 4.950 3.465 N RNF7 n/a
14 TRCN0000239801 GATGCCTGCCTTCGATGTCAA pLKO_005 261 CDS 100% 4.950 3.465 N LOC639931 n/a
15 TRCN0000012877 GCCTTCGATGTCAAGCTGAAA pLKO.1 268 CDS 100% 4.950 3.465 N Rnf7 n/a
16 TRCN0000239803 GTAACCATTCCTTCCACAACT pLKO_005 325 CDS 100% 4.950 3.465 N LOC639931 n/a
17 TRCN0000012874 GTGTAACCATTCCTTCCACAA pLKO.1 323 CDS 100% 4.050 2.835 N Rnf7 n/a
18 TRCN0000294581 GTGTAACCATTCCTTCCACAA pLKO_005 323 CDS 100% 4.050 2.835 N Rnf7 n/a
19 TRCN0000243750 CAAGTCGGGAGGCGACAAGAT pLKO_005 159 CDS 100% 1.650 1.155 N LOC632465 n/a
20 TRCN0000239804 TGTGGGTGAAACAGAACAATC pLKO_005 358 CDS 100% 10.800 6.480 N LOC639931 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02212 pDONR223 100% 74% 45.2% None (many diffs) n/a
2 ccsbBroad304_02212 pLX_304 0% 74% 45.2% V5 (many diffs) n/a
3 TRCN0000469857 AGATTTCGTTCTTTTGATTCATAA pLX_317 100% 74% 45.2% V5 (many diffs) n/a
4 ccsbBroadEn_07450 pDONR223 100% 73.7% 44.4% None (many diffs) n/a
5 ccsbBroad304_07450 pLX_304 0% 73.7% 44.4% V5 (many diffs) n/a
Download CSV