Transcript: Human NM_001312673.2

Homo sapiens phosphate cytidylyltransferase 1, choline, alpha (PCYT1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PCYT1A (5130)
Length:
5546
CDS:
123..1226

Additional Resources:

NCBI RefSeq record:
NM_001312673.2
NBCI Gene record:
PCYT1A (5130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001312673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035727 GCCCTATGTCAGGGTAACTAT pLKO.1 293 CDS 100% 5.625 7.875 N PCYT1A n/a
2 TRCN0000307147 GCCCTATGTCAGGGTAACTAT pLKO_005 293 CDS 100% 5.625 7.875 N PCYT1A n/a
3 TRCN0000035726 CGTACCTCATTGTGGGAGTTT pLKO.1 439 CDS 100% 4.950 3.960 N PCYT1A n/a
4 TRCN0000289943 CGTACCTCATTGTGGGAGTTT pLKO_005 439 CDS 100% 4.950 3.960 N PCYT1A n/a
5 TRCN0000035728 CCGAGAATTCATTGGAAGTTT pLKO.1 968 CDS 100% 0.000 0.000 N PCYT1A n/a
6 TRCN0000035725 GCCCATGATGATATTCCTTAT pLKO.1 621 CDS 100% 10.800 7.560 N PCYT1A n/a
7 TRCN0000289872 GCCCATGATGATATTCCTTAT pLKO_005 621 CDS 100% 10.800 7.560 N PCYT1A n/a
8 TRCN0000111503 GTTGACTTTAGTAAGCCCTAT pLKO.1 279 CDS 100% 4.050 2.835 N Pcyt1a n/a
9 TRCN0000035724 CCCTTTCTGTCCCATTACCTT pLKO.1 1252 3UTR 100% 3.000 2.100 N PCYT1A n/a
10 TRCN0000289871 CCCTTTCTGTCCCATTACCTT pLKO_005 1252 3UTR 100% 3.000 2.100 N PCYT1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01157 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01157 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476805 TCTCCTGTATCATCGGCTATGTAT pLX_317 26% 100% 100% V5 n/a
Download CSV