Transcript: Human NM_001314033.3

Homo sapiens zinc finger protein 526 (ZNF526), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF526 (116115)
Length:
4230
CDS:
433..2445

Additional Resources:

NCBI RefSeq record:
NM_001314033.3
NBCI Gene record:
ZNF526 (116115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001314033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232343 TTATCCCTGTTGTATAGATTT pLKO_005 3474 3UTR 100% 13.200 9.240 N ZNF526 n/a
2 TRCN0000232341 ACTTTGACTCCCTAGAGAAAG pLKO_005 1088 CDS 100% 10.800 7.560 N ZNF526 n/a
3 TRCN0000232339 GTGGAGATGTCAACACCTATG pLKO_005 490 CDS 100% 6.000 4.200 N ZNF526 n/a
4 TRCN0000232342 AGAGCCTCAACAGACTATCAT pLKO_005 2283 CDS 100% 5.625 3.938 N ZNF526 n/a
5 TRCN0000020699 CCACTTTGACTCCCTAGAGAA pLKO.1 1086 CDS 100% 4.950 3.465 N ZNF526 n/a
6 TRCN0000020701 CCTTGCCTCATCCCTCTTCTT pLKO.1 567 CDS 100% 4.950 3.465 N ZNF526 n/a
7 TRCN0000020700 CTACAACAAGAGTCCCTACTA pLKO.1 2133 CDS 100% 4.950 3.465 N ZNF526 n/a
8 TRCN0000020702 CAAGGGCTTCAAGAAGCTGAT pLKO.1 1866 CDS 100% 4.050 2.835 N ZNF526 n/a
9 TRCN0000020703 CAGTGGAGATGTCAACACCTA pLKO.1 488 CDS 100% 2.640 1.848 N ZNF526 n/a
10 TRCN0000232340 TCTGCAAACCAGATCCAATAC pLKO_005 832 CDS 100% 10.800 6.480 N ZNF526 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3525 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3526 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04693 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04693 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479338 CTGAATCAAGCTCCCACCTTGACC pLX_317 23.5% 100% 100% V5 n/a
Download CSV