Transcript: Human NM_001315533.1

Homo sapiens phosphodiesterase 9A (PDE9A), transcript variant 21, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PDE9A (5152)
Length:
1999
CDS:
284..1741

Additional Resources:

NCBI RefSeq record:
NM_001315533.1
NBCI Gene record:
PDE9A (5152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048894 CGGATAGATGACGCCATGAAA pLKO.1 1622 CDS 100% 5.625 7.875 N PDE9A n/a
2 TRCN0000048896 CGTCCACGACAACTACAGAAA pLKO.1 862 CDS 100% 4.950 6.930 N PDE9A n/a
3 TRCN0000174079 CGTCCACGACAACTACAGAAA pLKO.1 862 CDS 100% 4.950 6.930 N PDE9A n/a
4 TRCN0000048895 GCGTGGAATTGGAAGGACTAA pLKO.1 519 CDS 100% 4.950 6.930 N PDE9A n/a
5 TRCN0000048897 CGCCATGAAAGAGTTACAGAA pLKO.1 1633 CDS 100% 4.950 3.960 N PDE9A n/a
6 TRCN0000421675 ACAACACGTACCAGATCAATG pLKO_005 1038 CDS 100% 10.800 7.560 N PDE9A n/a
7 TRCN0000048893 TGGCACCACAAGACCATGTTT pLKO.1 1828 3UTR 100% 5.625 3.938 N PDE9A n/a
8 TRCN0000418805 GAAATGCAAGAGTGACATTAA pLKO_005 556 CDS 100% 13.200 7.920 N PDE9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06705 pDONR223 100% 89.2% 84.3% None (many diffs) n/a
2 ccsbBroad304_06705 pLX_304 0% 89.2% 84.3% V5 (many diffs) n/a
3 TRCN0000473983 GAACATACGTAAATTATCTCATAT pLX_317 31.7% 89.2% 84.3% V5 (many diffs) n/a
Download CSV