Transcript: Human NM_001317813.2

Homo sapiens solute carrier family 25 member 37 (SLC25A37), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC25A37 (51312)
Length:
4796
CDS:
388..1188

Additional Resources:

NCBI RefSeq record:
NM_001317813.2
NBCI Gene record:
SLC25A37 (51312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245154 TGCGTGTCTACACCTAGTATT pLKO_005 1682 3UTR 100% 13.200 18.480 N SLC25A37 n/a
2 TRCN0000245151 TCCACGATGCGGTAATGAATC pLKO_005 638 CDS 100% 10.800 15.120 N SLC25A37 n/a
3 TRCN0000245150 AGGCGTCAACGTCATGATCAT pLKO_005 486 CDS 100% 4.950 6.930 N SLC25A37 n/a
4 TRCN0000044009 CGTCTGTAAGACCCTTCTGAA pLKO.1 939 CDS 100% 4.950 3.960 N SLC25A37 n/a
5 TRCN0000245153 TACTAAAGGAAGGGATCATAG pLKO_005 1183 CDS 100% 10.800 7.560 N SLC25A37 n/a
6 TRCN0000245152 TATGAGTTCTTCAAGTACTTT pLKO_005 1129 CDS 100% 5.625 3.938 N SLC25A37 n/a
7 TRCN0000044010 GCCATTTCTTGGTCTGTCTAT pLKO.1 1111 CDS 100% 4.950 3.465 N SLC25A37 n/a
8 TRCN0000044008 GCGGTAATGAATCCAGCAGAA pLKO.1 646 CDS 100% 4.050 2.835 N SLC25A37 n/a
9 TRCN0000044012 CTCCATACTAAAGGAAGGGAT pLKO.1 1178 CDS 100% 2.640 1.848 N SLC25A37 n/a
10 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 3603 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3535 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3702 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08276 pDONR223 100% 78.5% 78.6% None 0_1ins216;132G>A n/a
2 ccsbBroad304_08276 pLX_304 0% 78.5% 78.6% V5 0_1ins216;132G>A n/a
3 TRCN0000467264 CCGTACCATTAAGGCTAAAAATGA pLX_317 36.6% 78.5% 78.6% V5 0_1ins216;132G>A n/a
Download CSV