Transcript: Human NM_001318053.2

Homo sapiens DENN domain containing 2A (DENND2A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DENND2A (27147)
Length:
3679
CDS:
303..2690

Additional Resources:

NCBI RefSeq record:
NM_001318053.2
NBCI Gene record:
DENND2A (27147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178923 CCAATGAAGGAGAACCCTTAT pLKO.1 1431 CDS 100% 10.800 7.560 N DENND2A n/a
2 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 3143 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
3 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3539 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11848 pDONR223 100% 99.9% 99.8% None 467C>A n/a
2 ccsbBroad304_11848 pLX_304 0% 99.9% 99.8% V5 467C>A n/a
3 TRCN0000478088 GCCCTCAGTTAAGATAATTGTCTA pLX_317 15.6% 99.9% 99.8% V5 467C>A n/a
Download CSV