Transcript: Human NM_001318055.2

Homo sapiens zinc finger protein 426 (ZNF426), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF426 (79088)
Length:
6977
CDS:
489..1820

Additional Resources:

NCBI RefSeq record:
NM_001318055.2
NBCI Gene record:
ZNF426 (79088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016723 CCTTACATCCTCACGCCTTAT pLKO.1 1274 CDS 100% 10.800 7.560 N ZNF426 n/a
2 TRCN0000280581 CCTTACATCCTCACGCCTTAT pLKO_005 1274 CDS 100% 10.800 7.560 N ZNF426 n/a
3 TRCN0000016724 CCTCTACTGGTGAGAAACTTT pLKO.1 724 CDS 100% 5.625 3.938 N ZNF426 n/a
4 TRCN0000280580 CCTCTACTGGTGAGAAACTTT pLKO_005 724 CDS 100% 5.625 3.938 N ZNF426 n/a
5 TRCN0000016726 CAGATCATCAAACCCAGTCTA pLKO.1 405 5UTR 100% 4.950 3.465 N ZNF426 n/a
6 TRCN0000351614 CAGATCATCAAACCCAGTCTA pLKO_005 405 5UTR 100% 4.950 3.465 N ZNF426 n/a
7 TRCN0000016725 CCTTCAATTATTCCAACTCAT pLKO.1 1102 CDS 100% 4.950 3.465 N ZNF426 n/a
8 TRCN0000351616 CCTTCAATTATTCCAACTCAT pLKO_005 1102 CDS 100% 4.950 3.465 N ZNF426 n/a
9 TRCN0000016727 CCCAGAAACCATACACCTGTA pLKO.1 1486 CDS 100% 4.050 2.835 N ZNF426 n/a
10 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 4219 3UTR 100% 13.200 6.600 Y C9orf139 n/a
11 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1242 CDS 100% 4.950 2.475 Y ZNF829 n/a
12 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1080 CDS 100% 4.050 2.025 Y ZNF700 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1971 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1971 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1971 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1652 CDS 100% 13.200 6.600 Y Zfp977 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5190 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1243 CDS 100% 5.625 2.813 Y ZNF570 n/a
19 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1311 CDS 100% 6.000 3.000 Y Zfp612 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5190 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04046 pDONR223 100% 79.9% 79.9% None 0_1ins333 n/a
2 ccsbBroad304_04046 pLX_304 0% 79.9% 79.9% V5 0_1ins333 n/a
3 TRCN0000479546 CGCAAACATTCTATCAGCGGACCA pLX_317 25.4% 79.9% 79.9% V5 0_1ins333 n/a
Download CSV