Transcript: Human NM_001318234.2

Homo sapiens syntaphilin (SNPH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SNPH (9751)
Length:
5593
CDS:
704..2320

Additional Resources:

NCBI RefSeq record:
NM_001318234.2
NBCI Gene record:
SNPH (9751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130758 GCAGAAGTACTTCGTGGACAT pLKO.1 1324 CDS 100% 4.050 3.240 N SNPH n/a
2 TRCN0000147900 GCTGCTGACATTACCATTATT pLKO.1 3680 3UTR 100% 15.000 10.500 N SNPH n/a
3 TRCN0000150197 GCCTCTGAAACAGAAATCTTT pLKO.1 4990 3UTR 100% 5.625 3.938 N SNPH n/a
4 TRCN0000147156 CAAGAACAACCTGATTGACAA pLKO.1 1291 CDS 100% 4.950 3.465 N SNPH n/a
5 TRCN0000148877 CATCGACACTGTCAAGAACAA pLKO.1 1279 CDS 100% 4.950 3.465 N SNPH n/a
6 TRCN0000128545 GCTTTGCACTATGTTCACTTT pLKO.1 3339 3UTR 100% 4.950 3.465 N SNPH n/a
7 TRCN0000148668 CAACCTGATTGACAAGGACAA pLKO.1 1297 CDS 100% 4.050 2.835 N SNPH n/a
8 TRCN0000149181 CACTGTCAAGAACAACCTGAT pLKO.1 1285 CDS 100% 4.050 2.835 N SNPH n/a
9 TRCN0000129059 GAACAACCTGATTGACAAGGA pLKO.1 1294 CDS 100% 2.640 1.848 N SNPH n/a
10 TRCN0000130609 CAGCAATTCTGGCTCCTACAA pLKO.1 946 CDS 100% 4.950 2.970 N SNPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07482 pDONR223 100% 91.7% 91.8% None 1_132del;150A>T n/a
2 ccsbBroad304_07482 pLX_304 0% 91.7% 91.8% V5 1_132del;150A>T n/a
3 TRCN0000474208 CCCAGGGATGCGTGTCCGCGGATT pLX_317 31% 91.7% 91.8% V5 1_132del;150A>T n/a
Download CSV