Transcript: Human NM_001318483.1

Homo sapiens G protein-coupled receptor 139 (GPR139), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GPR139 (124274)
Length:
1573
CDS:
541..1323

Additional Resources:

NCBI RefSeq record:
NM_001318483.1
NBCI Gene record:
GPR139 (124274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367902 TACACATCATGTCCGACATTG pLKO_005 1049 CDS 100% 10.800 15.120 N GPR139 n/a
2 TRCN0000060652 CCGTTAACCATTGACAGGTAT pLKO.1 622 CDS 100% 4.950 6.930 N GPR139 n/a
3 TRCN0000360189 GTTAACCATTGACAGGTATAT pLKO_005 624 CDS 100% 13.200 10.560 N GPR139 n/a
4 TRCN0000060651 CCCGCATCATCATGATTCTTT pLKO.1 989 CDS 100% 5.625 4.500 N GPR139 n/a
5 TRCN0000360190 CCGCATCATCATGATTCTTTA pLKO_005 990 CDS 100% 13.200 9.240 N GPR139 n/a
6 TRCN0000060650 GCTCAGGAGGAAGAGCAATTT pLKO.1 888 CDS 100% 13.200 9.240 N GPR139 n/a
7 TRCN0000060649 GCACCCGGAAAGTCATTGTAA pLKO.1 692 CDS 100% 5.625 3.938 N GPR139 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04780 pDONR223 100% 73.6% 73.6% None 0_1ins279 n/a
2 ccsbBroad304_04780 pLX_304 0% 73.6% 73.6% V5 0_1ins279 n/a
3 TRCN0000475973 AGATTAGTCTCTCAATTGTTTGCC pLX_317 33.2% 73.6% 73.6% V5 0_1ins279 n/a
4 TRCN0000489785 AATCCTCTGCAGCCTTCCGTTTTT pLX_317 37.4% 73.4% 73.4% V5 0_1ins279;510A>G;780_781insG n/a
5 TRCN0000488706 CTTAATAAGTCGAAATCCGAGGAC pLX_317 32.3% 73.5% 73.6% V5 (not translated due to prior stop codon) 0_1ins279;510A>G n/a
6 TRCN0000489716 CGAGGCGCCGCAGTTACAATTATT pLX_317 35.4% 69% 68.9% V5 (many diffs) n/a
7 TRCN0000487816 TCCCTCTTACGGTAGGCACCAGTT pLX_317 26.8% 69.1% 69% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV