Transcript: Human NM_001318848.2

Homo sapiens canopy FGF signaling regulator 3 (CNPY3), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CNPY3 (10695)
Length:
1158
CDS:
92..547

Additional Resources:

NCBI RefSeq record:
NM_001318848.2
NBCI Gene record:
CNPY3 (10695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373716 AGAAGGCCTCTGGAGTCAAAT pLKO_005 336 CDS 100% 13.200 9.240 N CNPY3 n/a
2 TRCN0000433063 GAAGTCAGCCTTTGAGGAAAC pLKO_005 268 CDS 100% 6.000 4.200 N CNPY3 n/a
3 TRCN0000373717 AGGACCGGCAGCAATCGATTT pLKO_005 437 CDS 100% 10.800 5.400 Y CNPY3 n/a
4 TRCN0000163917 CCAGCAAATGCGAAGTGTGTA pLKO.1 228 CDS 100% 4.950 2.475 Y CNPY4 n/a
5 TRCN0000129597 CCTGGATTATAGCCTGCACAA pLKO.1 412 CDS 100% 4.050 2.025 Y CNPY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02510 pDONR223 100% 51.3% 45.5% None (many diffs) n/a
2 ccsbBroad304_02510 pLX_304 0% 51.3% 45.5% V5 (many diffs) n/a
3 TRCN0000474578 CGTCGATTGGCGGAGATGTTTTCT pLX_317 31.1% 51.3% 45.5% V5 (many diffs) n/a
Download CSV