Transcript: Human NM_001318890.1

Homo sapiens acyl-CoA synthetase medium chain family member 1 (ACSM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ACSM1 (116285)
Length:
2187
CDS:
205..1938

Additional Resources:

NCBI RefSeq record:
NM_001318890.1
NBCI Gene record:
ACSM1 (116285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413792 AGTCGGAAACGGGACTAATTT pLKO_005 1310 CDS 100% 15.000 21.000 N ACSM1 n/a
2 TRCN0000413404 GCGGGTTGTACAGTCTTTATC pLKO_005 1057 CDS 100% 13.200 18.480 N ACSM1 n/a
3 TRCN0000422461 TATCGACTACAGTTGTCTAAA pLKO_005 658 CDS 100% 13.200 18.480 N ACSM1 n/a
4 TRCN0000437920 GAGGGCAAGAGAGGTCCAAAT pLKO_005 397 CDS 100% 10.800 7.560 N ACSM1 n/a
5 TRCN0000045701 CCAAGATGGAATGACTATGAA pLKO.1 316 CDS 100% 5.625 3.938 N ACSM1 n/a
6 TRCN0000045702 CTTCTGCTCTACGAGAACTAT pLKO.1 1285 CDS 100% 5.625 3.938 N ACSM1 n/a
7 TRCN0000045699 CCAAGGTCATCATACAGACAT pLKO.1 1100 CDS 100% 4.950 3.465 N ACSM1 n/a
8 TRCN0000045698 GCTGCCGGTCTTTATCAGAAT pLKO.1 287 CDS 100% 4.950 3.465 N ACSM1 n/a
9 TRCN0000045700 GACCCAGAGAAGACAGCTAAA pLKO.1 1507 CDS 100% 10.800 6.480 N ACSM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09432 pDONR223 100% 99.8% 100% None 1362T>A;1458C>T;1647G>A n/a
2 ccsbBroad304_09432 pLX_304 0% 99.8% 100% V5 1362T>A;1458C>T;1647G>A n/a
3 TRCN0000473697 TTTATTGACAGCAGCCAGGTGCTC pLX_317 29.2% 99.8% 100% V5 1362T>A;1458C>T;1647G>A n/a
Download CSV