Transcript: Human NM_001318937.2

Homo sapiens ribosomal protein S6 kinase A2 (RPS6KA2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RPS6KA2 (6196)
Length:
5687
CDS:
382..2289

Additional Resources:

NCBI RefSeq record:
NM_001318937.2
NBCI Gene record:
RPS6KA2 (6196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149230 GCCTCCCCACTGAGGAACTG pXPR_003 CGG 546 29% 8 0.4205 RPS6KA2 RPS6KA2 75735
2 BRDN0001148104 GGGGACCACTCACATCCTTG pXPR_003 AGG 1124 59% 13 0.3806 RPS6KA2 RPS6KA2 75733
3 BRDN0001148851 AGGAGTACGCTCTCTTGTCG pXPR_003 TGG 344 18% 6 0.1483 RPS6KA2 RPS6KA2 75734
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230081 TCGATATCTGACGCAGCTAAA pLKO_005 2005 CDS 100% 10.800 15.120 N RPS6KA2 n/a
2 TRCN0000218411 TCTATGATGATGGCAAGTTTG pLKO_005 1511 CDS 100% 10.800 15.120 N RPS6KA2 n/a
3 TRCN0000006355 GCAAGTTTGTGTACCTGGTAA pLKO.1 1523 CDS 100% 4.950 6.930 N RPS6KA2 n/a
4 TRCN0000196389 GCTCTGTCCTTACATGTATTT pLKO.1 4485 3UTR 100% 13.200 10.560 N RPS6KA2 n/a
5 TRCN0000230079 TTGACGGAGTGGAGGAAATTA pLKO_005 1004 CDS 100% 15.000 10.500 N RPS6KA2 n/a
6 TRCN0000230080 ACCCTGCTACACGGCCAATTT pLKO_005 1797 CDS 100% 13.200 9.240 N RPS6KA2 n/a
7 TRCN0000195208 CAAACGCTCATCACCTGTTTA pLKO.1 1187 CDS 100% 13.200 9.240 N RPS6KA2 n/a
8 TRCN0000006354 CGCCACCTACTTTGCTCTAAA pLKO.1 2175 CDS 100% 13.200 9.240 N RPS6KA2 n/a
9 TRCN0000230082 CGCCACCTACTTTGCTCTAAA pLKO_005 2175 CDS 100% 13.200 9.240 N RPS6KA2 n/a
10 TRCN0000196388 GCCGTGAAGATCATTGATAAG pLKO.1 1411 CDS 100% 10.800 7.560 N RPS6KA2 n/a
11 TRCN0000199744 GCGTGTGACATCTGGAGTTTG pLKO.1 1858 CDS 100% 10.800 7.560 N RPS6KA2 n/a
12 TRCN0000006352 CCAGATTCAAATGAGGAGTAA pLKO.1 2911 3UTR 100% 4.950 3.465 N RPS6KA2 n/a
13 TRCN0000006353 CCCTTCATTGTGAAGCTTCAT pLKO.1 442 CDS 100% 4.950 3.465 N RPS6KA2 n/a
14 TRCN0000022712 GCATGAAGAGACTCACGTCTA pLKO.1 2258 CDS 100% 4.050 5.670 N Rps6ka2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487867 TATTGTCCAGCGGTTTTTGCCCCT pLX_317 8.8% 85.9% 85.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14831 pDONR223 72.3% 85.4% 20.7% None (many diffs) n/a
3 ccsbBroad304_14831 pLX_304 0% 85.4% 20.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV