Transcript: Human NM_001319197.1

Homo sapiens S100 calcium binding protein A8 (S100A8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
S100A8 (6279)
Length:
546
CDS:
116..466

Additional Resources:

NCBI RefSeq record:
NM_001319197.1
NBCI Gene record:
S100A8 (6279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053774 GTCTGGTTCAAAGAGTTGGAT pLKO.1 341 CDS 100% 3.000 4.200 N S100A8 n/a
2 TRCN0000053773 CCACAAGTACTCCCTGATAAA pLKO.1 232 CDS 100% 13.200 9.240 N S100A8 n/a
3 TRCN0000426401 GGAATTTCCATGCCGTCTACA pLKO_005 255 CDS 100% 4.950 3.465 N S100A8 n/a
4 TRCN0000053775 TCAACACTGATGGTGCAGTTA pLKO.1 363 CDS 100% 4.950 3.465 N S100A8 n/a
5 TRCN0000053776 GAACTCTATCATCGACGTCTA pLKO.1 211 CDS 100% 4.050 2.835 N S100A8 n/a
6 TRCN0000434787 AGAGTTGGATATCAACACTGA pLKO_005 352 CDS 100% 2.640 1.848 N S100A8 n/a
7 TRCN0000053777 GTGTCCTCAGTATATCAGGAA pLKO.1 307 CDS 100% 2.640 1.584 N S100A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01476 pDONR223 100% 80.1% 80.1% None 1_69del n/a
2 ccsbBroad304_01476 pLX_304 0% 80.1% 80.1% V5 1_69del n/a
3 TRCN0000472439 ACATTTAGGTCCGAAAGTATATTC pLX_317 100% 80.1% 80.1% V5 1_69del n/a
Download CSV