Transcript: Human NM_001319985.1

Homo sapiens mago homolog B, exon junction complex subunit (MAGOHB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-11
Taxon:
Homo sapiens (human)
Gene:
MAGOHB (55110)
Length:
2507
CDS:
114..422

Additional Resources:

NCBI RefSeq record:
NM_001319985.1
NBCI Gene record:
MAGOHB (55110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424847 GATACTTTAGGTGGAACTATG pLKO_005 783 3UTR 100% 10.800 15.120 N MAGOHB n/a
2 TRCN0000434519 CTATGTCTCTAATTCACTTTA pLKO_005 718 3UTR 100% 13.200 9.240 N MAGOHB n/a
3 TRCN0000417493 ATTGATGTAAATCAGTCAAAG pLKO_005 303 CDS 100% 10.800 7.560 N MAGOHB n/a
4 TRCN0000419872 CCAGATTCCCATCCATGAAAG pLKO_005 807 3UTR 100% 10.800 7.560 N MAGOHB n/a
5 TRCN0000072323 CCTTCATACATGATTGGATTT pLKO.1 852 3UTR 100% 10.800 7.560 N MAGOHB n/a
6 TRCN0000072326 TGGTACAAGACTTGAAATGTT pLKO.1 355 CDS 100% 5.625 3.938 N MAGOHB n/a
7 TRCN0000072325 GTAATTGGAGATGAGCACATA pLKO.1 252 CDS 100% 4.950 3.465 N MAGOHB n/a
8 TRCN0000174953 GATGTAAATCAGTCAAAGGAT pLKO.1 306 CDS 100% 3.000 2.100 N Magohb n/a
9 TRCN0000353317 GATGTAAATCAGTCAAAGGAT pLKO_005 306 CDS 100% 3.000 2.100 N Magohb n/a
10 TRCN0000215508 GAAGAACTGAAGAGAATTATT pLKO.1 153 CDS 100% 15.000 9.000 N Magohb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00970 pDONR223 100% 60.7% 69.8% None (many diffs) n/a
2 ccsbBroad304_00970 pLX_304 0% 60.7% 69.8% V5 (many diffs) n/a
3 TRCN0000472892 GCGCCTCGAAAGTTGTCGTGATGT pLX_317 100% 60.7% 69.8% V5 (many diffs) n/a
Download CSV