Transcript: Human NM_001320147.2

Homo sapiens CaM kinase like vesicle associated (CAMKV), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CAMKV (79012)
Length:
2905
CDS:
164..1576

Additional Resources:

NCBI RefSeq record:
NM_001320147.2
NBCI Gene record:
CAMKV (79012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381491 TGACCCGCAAGGAGTACTTTA pLKO_005 432 CDS 100% 13.200 18.480 N CAMKV n/a
2 TRCN0000379763 CTCCATATTGGGATGATATTT pLKO_005 909 CDS 100% 15.000 10.500 N CAMKV n/a
3 TRCN0000194988 CCCTGTTATTTGTGTTATTTC pLKO.1 2237 3UTR 100% 13.200 9.240 N CAMKV n/a
4 TRCN0000196332 GATGAGGAAGTAGGGTTAAAC pLKO.1 2669 3UTR 100% 13.200 9.240 N CAMKV n/a
5 TRCN0000338293 GATGAGGAAGTAGGGTTAAAC pLKO_005 2669 3UTR 100% 13.200 9.240 N CAMKV n/a
6 TRCN0000010255 CGGCTGAAGAACTCGAAGATT pLKO.1 629 CDS 100% 5.625 3.938 N CAMKV n/a
7 TRCN0000196494 GAACCATGATAAGAATCTCTT pLKO.1 853 CDS 100% 4.950 3.465 N CAMKV n/a
8 TRCN0000197139 GATTTGGGACAGGTCATCAAG pLKO.1 236 CDS 100% 4.950 3.465 N CAMKV n/a
9 TRCN0000010256 TTGGGATGATATTTCGCAGGC pLKO.1 916 CDS 100% 1.200 0.840 N CAMKV n/a
10 TRCN0000010257 GAGCAAGACCAGCGGATCACT pLKO.1 971 CDS 100% 1.000 0.700 N CAMKV n/a
11 TRCN0000338351 GAGCAAGACCAGCGGATCACT pLKO_005 971 CDS 100% 1.000 0.700 N CAMKV n/a
12 TRCN0000010254 GCGGAAAGCTGCCAAGAACGA pLKO.1 352 CDS 100% 0.880 0.616 N CAMKV n/a
13 TRCN0000350906 GCGGAAAGCTGCCAAGAACGA pLKO_005 352 CDS 100% 0.880 0.616 N CAMKV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15976 pDONR223 0% 93.8% 93.8% None 1050_1051ins93 n/a
2 ccsbBroad304_15976 pLX_304 0% 93.8% 93.8% V5 1050_1051ins93 n/a
3 TRCN0000468820 GGACTTTCAGGCCCATTATAGCAA pLX_317 23.9% 93.8% 93.8% V5 1050_1051ins93 n/a
4 ccsbBroadEn_08905 pDONR223 100% 93.7% 93.6% None 1050_1051ins93;1379A>G n/a
5 ccsbBroad304_08905 pLX_304 0% 93.7% 93.6% V5 1050_1051ins93;1379A>G n/a
6 TRCN0000470705 TTCGAGTATTGTATCTAGCTCCCG pLX_317 27.9% 93.7% 93.6% V5 1050_1051ins93;1379A>G n/a
7 ccsbBroadEn_15144 pDONR223 0% 93.7% 93.6% None 1050_1051ins93;1379A>G n/a
8 ccsbBroad304_15144 pLX_304 0% 93.7% 93.6% V5 1050_1051ins93;1379A>G n/a
9 TRCN0000480536 TCCTCTTTAGGCTTTAACAAGCTC pLX_317 27.9% 93.7% 93.6% V5 1050_1051ins93;1379A>G n/a
Download CSV