Transcript: Human NM_001320269.2

Homo sapiens KN motif and ankyrin repeat domains 4 (KANK4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KANK4 (163782)
Length:
3615
CDS:
400..1503

Additional Resources:

NCBI RefSeq record:
NM_001320269.2
NBCI Gene record:
KANK4 (163782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441425 AGCTGGCTACACTGCCGTAAT pLKO_005 1083 CDS 100% 10.800 15.120 N KANK4 n/a
2 TRCN0000099586 CGACCAGCCTTAAATCCATAA pLKO.1 428 CDS 100% 10.800 15.120 N Kank4 n/a
3 TRCN0000146391 CGTATCCATTACCTCATGGTA pLKO.1 2387 3UTR 100% 3.000 4.200 N KANK4 n/a
4 TRCN0000150212 CCCTAGAAGCAAATATCTGTT pLKO.1 2433 3UTR 100% 4.950 3.465 N KANK4 n/a
5 TRCN0000150287 GAGAGATATAAACCCTCAGAA pLKO.1 742 CDS 100% 4.950 3.465 N KANK4 n/a
6 TRCN0000148155 GCACATACATTCCTGTTGTAT pLKO.1 1630 3UTR 100% 0.563 0.394 N KANK4 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2904 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2905 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 3041 3UTR 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09754 pDONR223 100% 36.5% 36% None (many diffs) n/a
2 ccsbBroad304_09754 pLX_304 0% 36.5% 36% V5 (many diffs) n/a
3 TRCN0000475731 GTCGCCTAGCGGGCTAAGTGACGC pLX_317 10.5% 36.5% 36% V5 (many diffs) n/a
Download CSV