Transcript: Human NM_001320313.2

Homo sapiens ADAM metallopeptidase domain 18 (ADAM18), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ADAM18 (8749)
Length:
2328
CDS:
56..2203

Additional Resources:

NCBI RefSeq record:
NM_001320313.2
NBCI Gene record:
ADAM18 (8749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052221 CCACGAAGGTTCTGAAGGAAT pLKO.1 103 CDS 100% 4.950 6.930 N ADAM18 n/a
2 TRCN0000412436 AGCAAGATTTGAGCATATAAT pLKO_005 454 CDS 100% 15.000 10.500 N ADAM18 n/a
3 TRCN0000424916 CAAGGATATGCTGCCGAATTT pLKO_005 338 CDS 100% 13.200 9.240 N ADAM18 n/a
4 TRCN0000052220 GCTTGTGTTCAGCCACATAAA pLKO.1 1637 CDS 100% 13.200 9.240 N ADAM18 n/a
5 TRCN0000052222 CCTATTGCTATAACGGACAAT pLKO.1 1446 CDS 100% 4.950 3.465 N ADAM18 n/a
6 TRCN0000052218 GCCTTAATGTAGGATTAACAT pLKO.1 948 CDS 100% 0.563 0.394 N ADAM18 n/a
7 TRCN0000052219 CCAGCCCTACAAAGTTCCTTT pLKO.1 547 CDS 100% 4.950 2.970 N ADAM18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02007 pDONR223 100% 96.7% 96.7% None 588_589ins72 n/a
2 ccsbBroad304_02007 pLX_304 0% 96.7% 96.7% V5 588_589ins72 n/a
3 TRCN0000470152 ATGTGTTGACGTCTTTACATGCTG pLX_317 18.6% 96.7% 96.7% V5 588_589ins72 n/a
4 ccsbBroadEn_02006 pDONR223 100% 25.1% 24.4% None (many diffs) n/a
5 ccsbBroad304_02006 pLX_304 0% 25.1% 24.4% V5 (many diffs) n/a
6 TRCN0000491657 GGGTGGCCTTCCAATCGAATCCGG pLX_317 66.6% 25.1% 24.4% V5 (many diffs) n/a
Download CSV