Transcript: Human NM_001320699.2

Homo sapiens SET domain bifurcated histone lysine methyltransferase 2 (SETDB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SETDB2 (83852)
Length:
5882
CDS:
605..2728

Additional Resources:

NCBI RefSeq record:
NM_001320699.2
NBCI Gene record:
SETDB2 (83852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159493 CCAGGAACACAATTAGGATAT pLKO.1 2885 3UTR 100% 10.800 7.560 N SETDB2 n/a
2 TRCN0000158918 CCAAGAATACTTCATCTGATT pLKO.1 2424 CDS 100% 4.950 3.465 N SETDB2 n/a
3 TRCN0000160242 CCTGTTTGTGAAATTAGCTTA pLKO.1 2743 3UTR 100% 4.950 3.465 N SETDB2 n/a
4 TRCN0000159789 GCTGATTGAATCAGATGTGAT pLKO.1 2224 CDS 100% 4.950 3.465 N SETDB2 n/a
5 TRCN0000158971 GTTTGAAGATAATCTGCTGAT pLKO.1 2209 CDS 100% 4.050 2.835 N SETDB2 n/a
6 TRCN0000159172 GCTGAAATTAAAGCCATGCAA pLKO.1 2768 3UTR 100% 3.000 2.100 N SETDB2 n/a
7 TRCN0000159348 GCATCACAGAAAGAAGTGAAT pLKO.1 779 CDS 100% 4.950 2.970 N SETDB2 n/a
8 TRCN0000159050 GAAGTTGAAGTTCTCCCATTA pLKO.1 1886 CDS 100% 10.800 5.400 Y SETDB2 n/a
9 TRCN0000158454 CCCATTTCTTTCTGTAATGAA pLKO.1 1328 CDS 100% 5.625 2.813 Y SETDB2 n/a
10 TRCN0000158972 GCAATGATTCTAGTGAATGAA pLKO.1 722 CDS 100% 5.625 2.813 Y SETDB2 n/a
11 TRCN0000238917 TGAGGGCTGCATAGACATAAA pLKO_005 1456 CDS 100% 13.200 6.600 Y Setdb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09118 pDONR223 100% 96.5% 96.3% None (many diffs) n/a
2 ccsbBroad304_09118 pLX_304 0% 96.5% 96.3% V5 (many diffs) n/a
3 TRCN0000478699 ACAGCTTAGAATAGGAATCCGACG pLX_317 17.1% 96.5% 96.3% V5 (many diffs) n/a
Download CSV