Transcript: Human NM_001320923.1

Homo sapiens Janus kinase 1 (JAK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
JAK1 (3716)
Length:
5021
CDS:
218..3682

Additional Resources:

NCBI RefSeq record:
NM_001320923.1
NBCI Gene record:
JAK1 (3716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144778 CCGGAAGTAGCCATCTACCA pXPR_003 GGG 1225 35% 10 1.0552 JAK1 JAK1 76393
2 BRDN0001145887 GCCTAGACAGCACCGTAATG pXPR_003 GGG 2231 64% 17 0.7261 JAK1 JAK1 76392
3 BRDN0001149025 CACACTTACTCTCCACGTCG pXPR_003 CGG 1979 57% 15 -0.2570 JAK1 JAK1 76395
4 BRDN0001149081 TGGTTTCATTCGAATGACGG pXPR_003 TGG 917 26% 8 -1.0315 JAK1 JAK1 76394
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195125 CTATTTGGGTTCTCGGCAATA pLKO.1 3193 CDS 100% 10.800 15.120 N JAK1 n/a
2 TRCN0000121146 CCGTTGATCGTCCACAACATA pLKO.1 1505 CDS 100% 5.625 7.875 N JAK1 n/a
3 TRCN0000121215 GACAGTCACAAGACTTGTGAA pLKO.1 3514 CDS 100% 0.495 0.693 N JAK1 n/a
4 TRCN0000295869 GACAGTCACAAGACTTGTGAA pLKO_005 3514 CDS 100% 0.495 0.693 N JAK1 n/a
5 TRCN0000194761 CAGAACCTTATTGAAGGATTT pLKO.1 3644 CDS 100% 10.800 8.640 N JAK1 n/a
6 TRCN0000003102 GAGACTTCCATGTTACTGATT pLKO.1 1076 CDS 100% 4.950 3.960 N JAK1 n/a
7 TRCN0000295813 GAGACTTCCATGTTACTGATT pLKO_005 1076 CDS 100% 4.950 3.960 N JAK1 n/a
8 TRCN0000121276 GCATGGAACCAACGACAATGA pLKO.1 565 CDS 100% 4.950 3.960 N JAK1 n/a
9 TRCN0000003104 CTGAGCTACTTGGAGGATAAA pLKO.1 2321 CDS 100% 13.200 9.240 N JAK1 n/a
10 TRCN0000295867 CTGAGCTACTTGGAGGATAAA pLKO_005 2321 CDS 100% 13.200 9.240 N JAK1 n/a
11 TRCN0000196289 GAAACCGATAAGGAGTATTAC pLKO.1 3302 CDS 100% 13.200 9.240 N JAK1 n/a
12 TRCN0000121143 GCACGAGAACACACATCTATT pLKO.1 1992 CDS 100% 13.200 9.240 N JAK1 n/a
13 TRCN0000010760 TGCACAGAAGACGGAGGAAAT pLKO.1 3047 CDS 100% 10.800 7.560 N JAK1 n/a
14 TRCN0000121145 CCATGGAAATGTGTGTACTAA pLKO.1 2350 CDS 100% 5.625 3.938 N JAK1 n/a
15 TRCN0000121272 CCGAGCAGGATGGACATGATA pLKO.1 750 CDS 100% 5.625 3.938 N JAK1 n/a
16 TRCN0000121214 CTGAAATCACTCACATTGTAA pLKO.1 1326 CDS 100% 5.625 3.938 N JAK1 n/a
17 TRCN0000121213 GCGATATATTCCAGAAACATT pLKO.1 871 CDS 100% 5.625 3.938 N JAK1 n/a
18 TRCN0000003103 CATGCCGTATCTCTCCTCTTT pLKO.1 417 CDS 100% 4.950 3.465 N JAK1 n/a
19 TRCN0000121275 CGTTCTCTACTACGAAGTGAT pLKO.1 1144 CDS 100% 4.950 3.465 N JAK1 n/a
20 TRCN0000288591 CGTTCTCTACTACGAAGTGAT pLKO_005 1144 CDS 100% 4.950 3.465 N JAK1 n/a
21 TRCN0000121212 CTTCGGTTTAACCAAAGCAAT pLKO.1 3280 CDS 100% 4.950 3.465 N JAK1 n/a
22 TRCN0000121144 GCTCTGGGAAATCTGCTACAA pLKO.1 2563 CDS 100% 4.950 3.465 N JAK1 n/a
23 TRCN0000195042 CCACAGATTATCAAGTCCTTC pLKO.1 3706 3UTR 100% 4.050 2.835 N JAK1 n/a
24 TRCN0000121216 CGAGATCTTAAGGAACCTCTA pLKO.1 2995 CDS 100% 4.050 2.835 N JAK1 n/a
25 TRCN0000121274 GCCTTAAGGAATATCTTCCAA pLKO.1 3105 CDS 100% 3.000 2.100 N JAK1 n/a
26 TRCN0000121142 GCCATCAATAAATTGCGGCAA pLKO.1 1562 CDS 100% 2.160 1.512 N JAK1 n/a
27 TRCN0000003105 CTTGGCTACCTTGGAAACTTT pLKO.1 1027 CDS 100% 5.625 3.375 N JAK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14679 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14679 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465562 CTCTCCCACCCTTTATCTCAACTC pLX_317 7.8% 100% 100% V5 n/a
4 TRCN0000489926 TCGGACTTTGTCTTACAAAATCAC pLX_317 12.6% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488291 GCGCCAATAAGAGCGGCTGAAATA pLX_317 8.3% 99.8% 99.9% V5 (many diffs) n/a
Download CSV