Transcript: Human NM_001321357.1

Homo sapiens nuclear receptor binding protein 1 (NRBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NRBP1 (29959)
Length:
2898
CDS:
833..2440

Additional Resources:

NCBI RefSeq record:
NM_001321357.1
NBCI Gene record:
NRBP1 (29959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144722 AGGTATGCACTGTCAATACC pXPR_003 TGG 234 15% 4 0.6779 NRBP1 NRBP1 77019
2 BRDN0001145376 TCTGTGATAAAAATGACCTG pXPR_003 GGG 435 27% 6 0.631 NRBP1 NRBP1 77016
3 BRDN0001145499 GCACTTCAAACAATGCTGGG pXPR_003 TGG 974 61% 12 0.1403 NRBP1 NRBP1 77018
4 BRDN0001147466 CACTAATGTGACAACAGCAG pXPR_003 TGG 766 48% 10 -0.4426 NRBP1 NRBP1 77017
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197123 GCAATGGAGAGTCCTCATATG pLKO.1 1659 CDS 100% 0.000 0.000 N NRBP1 n/a
2 TRCN0000001440 AGGCGAGAAGAGGTGAATCAA pLKO.1 1031 CDS 100% 5.625 3.938 N NRBP1 n/a
3 TRCN0000352626 AGGCGAGAAGAGGTGAATCAA pLKO_005 1031 CDS 100% 5.625 3.938 N NRBP1 n/a
4 TRCN0000001437 CCCTCTGCACTTTGTTTACTT pLKO.1 2621 3UTR 100% 5.625 3.938 N NRBP1 n/a
5 TRCN0000194879 CCTGACACTATCAACAATCAT pLKO.1 1499 CDS 100% 5.625 3.938 N NRBP1 n/a
6 TRCN0000001439 TGTCGAGAAGAGCAGAAGAAT pLKO.1 1529 CDS 100% 5.625 3.938 N NRBP1 n/a
7 TRCN0000342386 TGTCGAGAAGAGCAGAAGAAT pLKO_005 1529 CDS 100% 5.625 3.938 N NRBP1 n/a
8 TRCN0000222269 CAAAGGTAGAATCCTCATCTT pLKO.1 879 CDS 100% 4.950 3.465 N Nrbp1 n/a
9 TRCN0000001441 CATCTGGGAGTCTGAAGCAAT pLKO.1 1293 CDS 100% 4.950 3.465 N NRBP1 n/a
10 TRCN0000342430 CATCTGGGAGTCTGAAGCAAT pLKO_005 1293 CDS 100% 4.950 3.465 N NRBP1 n/a
11 TRCN0000001438 CCAACACATGATCCCAGAGAA pLKO.1 1864 CDS 100% 4.950 3.465 N NRBP1 n/a
12 TRCN0000342429 CCAACACATGATCCCAGAGAA pLKO_005 1864 CDS 100% 4.950 3.465 N NRBP1 n/a
13 TRCN0000196670 GACCTTGAACAAGTTCAATTT pLKO.1 2371 CDS 100% 1.320 0.924 N NRBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03118 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03118 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469517 GTTGCGTTATAGTGTGGGCTCCCA pLX_317 19.9% 100% 100% V5 n/a
4 ccsbBroadEn_15053 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15053 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000479921 CTGCACCCACATCTAGGCCCCACG pLX_317 23.8% 100% 100% V5 n/a
7 TRCN0000488869 TCGCCACGAGTGTCCCACGTATGG pLX_317 19.4% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV