Transcript: Human NM_001321363.2

Homo sapiens nuclear receptor binding protein 1 (NRBP1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NRBP1 (29959)
Length:
2085
CDS:
127..1638

Additional Resources:

NCBI RefSeq record:
NM_001321363.2
NBCI Gene record:
NRBP1 (29959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197123 GCAATGGAGAGTCCTCATATG pLKO.1 857 CDS 100% 0.000 0.000 N NRBP1 n/a
2 TRCN0000001440 AGGCGAGAAGAGGTGAATCAA pLKO.1 325 CDS 100% 5.625 3.938 N NRBP1 n/a
3 TRCN0000352626 AGGCGAGAAGAGGTGAATCAA pLKO_005 325 CDS 100% 5.625 3.938 N NRBP1 n/a
4 TRCN0000001437 CCCTCTGCACTTTGTTTACTT pLKO.1 1819 3UTR 100% 5.625 3.938 N NRBP1 n/a
5 TRCN0000194879 CCTGACACTATCAACAATCAT pLKO.1 697 CDS 100% 5.625 3.938 N NRBP1 n/a
6 TRCN0000001439 TGTCGAGAAGAGCAGAAGAAT pLKO.1 727 CDS 100% 5.625 3.938 N NRBP1 n/a
7 TRCN0000342386 TGTCGAGAAGAGCAGAAGAAT pLKO_005 727 CDS 100% 5.625 3.938 N NRBP1 n/a
8 TRCN0000222269 CAAAGGTAGAATCCTCATCTT pLKO.1 173 CDS 100% 4.950 3.465 N Nrbp1 n/a
9 TRCN0000001441 CATCTGGGAGTCTGAAGCAAT pLKO.1 491 CDS 100% 4.950 3.465 N NRBP1 n/a
10 TRCN0000342430 CATCTGGGAGTCTGAAGCAAT pLKO_005 491 CDS 100% 4.950 3.465 N NRBP1 n/a
11 TRCN0000001438 CCAACACATGATCCCAGAGAA pLKO.1 1062 CDS 100% 4.950 3.465 N NRBP1 n/a
12 TRCN0000342429 CCAACACATGATCCCAGAGAA pLKO_005 1062 CDS 100% 4.950 3.465 N NRBP1 n/a
13 TRCN0000196670 GACCTTGAACAAGTTCAATTT pLKO.1 1569 CDS 100% 1.320 0.924 N NRBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03118 pDONR223 100% 94% 94% None 338_339ins96 n/a
2 ccsbBroad304_03118 pLX_304 0% 94% 94% V5 338_339ins96 n/a
3 TRCN0000469517 GTTGCGTTATAGTGTGGGCTCCCA pLX_317 19.9% 94% 94% V5 338_339ins96 n/a
4 ccsbBroadEn_15053 pDONR223 0% 94% 94% None 338_339ins96 n/a
5 ccsbBroad304_15053 pLX_304 0% 94% 94% V5 338_339ins96 n/a
6 TRCN0000479921 CTGCACCCACATCTAGGCCCCACG pLX_317 23.8% 94% 94% V5 338_339ins96 n/a
7 TRCN0000488869 TCGCCACGAGTGTCCCACGTATGG pLX_317 19.4% 94% 94% V5 (not translated due to prior stop codon) 338_339ins96 n/a
Download CSV