Transcript: Human NM_001321627.1

Homo sapiens family with sequence similarity 126 member B (FAM126B), transcript variant 10, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
FAM126B (285172)
Length:
9559
CDS:
493..2007

Additional Resources:

NCBI RefSeq record:
NM_001321627.1
NBCI Gene record:
FAM126B (285172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419151 AGCTTCAATCCGTCGTCATAG pLKO_005 1203 CDS 100% 10.800 15.120 N FAM126B n/a
2 TRCN0000417201 ATCAATAGCTTAAGTCTAATC pLKO_005 1732 CDS 100% 10.800 15.120 N FAM126B n/a
3 TRCN0000167117 CCGAAGACATAAATGTTCAAT pLKO.1 2615 3UTR 100% 5.625 7.875 N FAM126B n/a
4 TRCN0000168476 GCAGGACTCTTGATTGTGTAA pLKO.1 2679 3UTR 100% 4.950 6.930 N FAM126B n/a
5 TRCN0000430318 ACTGAGGGAGGTACTAATTTA pLKO_005 1831 CDS 100% 15.000 12.000 N FAM126B n/a
6 TRCN0000215473 GTTTCAATATGCAGCTAATAT pLKO.1 1976 CDS 100% 15.000 10.500 N Fam126b n/a
7 TRCN0000182451 GCCAGTGCTTCCTCAAGTAAA pLKO.1 1759 CDS 100% 13.200 9.240 N Fam126b n/a
8 TRCN0000420976 TAGCTCAGAGGTTCGACTTAA pLKO_005 441 5UTR 100% 13.200 9.240 N FAM126B n/a
9 TRCN0000433355 ACACTCAGATCACCAGTTATG pLKO_005 252 5UTR 100% 10.800 7.560 N FAM126B n/a
10 TRCN0000167619 GCTGATAAAGATGGGAACAAT pLKO.1 586 CDS 100% 5.625 3.938 N FAM126B n/a
11 TRCN0000172874 GCAGCTAATATCCCAGGTGTA pLKO.1 1986 CDS 100% 4.050 2.835 N FAM126B n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4598 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4595 3UTR 100% 4.950 2.475 Y LOC339059 n/a
14 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4522 3UTR 100% 4.950 2.475 Y GJD4 n/a
15 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4522 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09973 pDONR223 100% 76.4% 76.4% None 0_1ins246;745_912del n/a
2 ccsbBroad304_09973 pLX_304 0% 76.4% 76.4% V5 0_1ins246;745_912del n/a
3 TRCN0000466386 TGGGCATATTGCTTGCTGACCTTC pLX_317 26.7% 76.4% 76.4% V5 0_1ins246;745_912del n/a
Download CSV