Transcript: Human NM_001322329.1

Homo sapiens chromosome 2 open reading frame 76 (C2orf76), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
C2orf76 (130355)
Length:
1173
CDS:
523..903

Additional Resources:

NCBI RefSeq record:
NM_001322329.1
NBCI Gene record:
C2orf76 (130355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121727 CAATTTCAAACCTGTAGTGTA pLKO.1 579 CDS 100% 4.950 6.930 N C2orf76 n/a
2 TRCN0000144604 GCATACCTGTATTAAGCTCTT pLKO.1 928 3UTR 100% 4.050 5.670 N C2orf76 n/a
3 TRCN0000122352 CACGGAGTGAATTTGGACCAA pLKO.1 601 CDS 100% 2.640 3.696 N C2orf76 n/a
4 TRCN0000139520 CCGTTCCTTTGAACATCGCAA pLKO.1 561 CDS 100% 2.640 2.112 N C2orf76 n/a
5 TRCN0000177609 CAGTGAAACTGAAATTGCATT pLKO.1 828 CDS 100% 4.950 3.465 N 3110009E18Rik n/a
6 TRCN0000320313 CAGTGAAACTGAAATTGCATT pLKO_005 828 CDS 100% 4.950 3.465 N 3110009E18Rik n/a
7 TRCN0000143570 GAATCGCCAGTGAAACTGAAA pLKO.1 821 CDS 100% 4.950 3.465 N C2orf76 n/a
8 TRCN0000140687 GACGAAAGACTCCTGCTGAAA pLKO.1 775 CDS 100% 4.950 3.465 N C2orf76 n/a
9 TRCN0000144100 CCAGTGAAACTGAAATTGCAT pLKO.1 827 CDS 100% 3.000 2.100 N C2orf76 n/a
10 TRCN0000142934 CAGGCTATACTCTTTGAGCTA pLKO.1 1002 3UTR 100% 2.640 1.848 N C2orf76 n/a
11 TRCN0000145078 GAACTACAAAGCTAATCCCAT pLKO.1 870 CDS 100% 2.640 1.848 N C2orf76 n/a
12 TRCN0000144146 CTTTCTCTTCAGGTCTTTCTT pLKO.1 1037 3UTR 100% 5.625 3.938 N C2orf76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04860 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04860 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470846 AAGGCAACAGCAAATGCTGTGGCG pLX_317 94.7% 100% 100% V5 n/a
Download CSV