Transcript: Human NM_001322814.2

Homo sapiens superoxide dismutase 2 (SOD2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SOD2 (6648)
Length:
14050
CDS:
75..626

Additional Resources:

NCBI RefSeq record:
NM_001322814.2
NBCI Gene record:
SOD2 (6648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320665 GGATGCCTTTCTAGTCCTATT pLKO_005 935 3UTR 100% 10.800 15.120 N SOD2 n/a
2 TRCN0000005940 GCACGCTTACTACCTTCAGTA pLKO.1 515 CDS 100% 4.950 6.930 N SOD2 n/a
3 TRCN0000320739 GCACGCTTACTACCTTCAGTA pLKO_005 515 CDS 100% 4.950 6.930 N SOD2 n/a
4 TRCN0000311411 GCTTACTACCTTCAGTATAAA pLKO_005 519 CDS 100% 15.000 10.500 N Sod2 n/a
5 TRCN0000350349 TTGGTTCCTTTGACAAGTTTA pLKO_005 331 CDS 100% 13.200 9.240 N SOD2 n/a
6 TRCN0000005942 GCAAGGAACAACAGGCCTTAT pLKO.1 467 CDS 100% 10.800 7.560 N SOD2 n/a
7 TRCN0000350277 GCAAGGAACAACAGGCCTTAT pLKO_005 467 CDS 100% 10.800 7.560 N SOD2 n/a
8 TRCN0000005939 GCTGAGTATGTTAAGCTCTTT pLKO.1 641 3UTR 100% 4.950 3.465 N SOD2 n/a
9 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 2285 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2386 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2350 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000136627 GCTCTCTGTTTGTCTGTTGTT pLKO.1 8150 3UTR 100% 4.950 2.475 Y FSIP2 n/a
13 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2184 3UTR 100% 0.495 0.248 Y C11orf44 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2423 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2423 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322814.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11148 pDONR223 100% 60.3% 44.4% None (many diffs) n/a
2 ccsbBroad304_11148 pLX_304 0% 60.3% 44.4% V5 (many diffs) n/a
3 TRCN0000478320 ACACATACCAAAACTCGCTCTCCT pLX_317 59% 60.3% 44.4% V5 (many diffs) n/a
Download CSV