Transcript: Human NM_001323031.2

Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SV2B (9899)
Length:
12559
CDS:
495..2546

Additional Resources:

NCBI RefSeq record:
NM_001323031.2
NBCI Gene record:
SV2B (9899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060092 CCTTCGGCATTCTCAATGGAT pLKO.1 2371 CDS 100% 3.000 4.200 N SV2B n/a
2 TRCN0000060088 CGCCACAATCAACTTCACGAT pLKO.1 1805 CDS 100% 2.640 3.696 N SV2B n/a
3 TRCN0000419829 AGTTCATCAACTGTCGGTTTA pLKO_005 2017 CDS 100% 10.800 8.640 N SV2B n/a
4 TRCN0000423719 GATGAAGAATACAAGTCTAAA pLKO_005 1752 CDS 100% 13.200 9.240 N SV2B n/a
5 TRCN0000060091 CCCAAGGTTTCTGCTAGAGAT pLKO.1 1394 CDS 100% 4.950 3.465 N SV2B n/a
6 TRCN0000060090 GCAAGATAATGACTTCCTGAT pLKO.1 2087 CDS 100% 4.050 2.835 N SV2B n/a
7 TRCN0000060089 CCAGAGAAAGTGTTCACGGTT pLKO.1 1485 CDS 100% 2.640 1.848 N SV2B n/a
8 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 9788 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9896 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 12534 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 12534 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 12534 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9896 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07507 pDONR223 100% 99.9% 100% None 279C>T n/a
2 ccsbBroad304_07507 pLX_304 0% 99.9% 100% V5 279C>T n/a
3 TRCN0000471954 TTATTTTCTAGTAGTGGCCCTGGC pLX_317 18.7% 99.9% 100% V5 279C>T n/a
Download CSV