Transcript: Human NM_001323544.2

Homo sapiens galactosamine (N-acetyl)-6-sulfatase (GALNS), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GALNS (2588)
Length:
2514
CDS:
223..1809

Additional Resources:

NCBI RefSeq record:
NM_001323544.2
NBCI Gene record:
GALNS (2588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236077 TGGACAGGCCTATCTTCTATT pLKO_005 1373 CDS 100% 13.200 18.480 N GALNS n/a
2 TRCN0000051701 CGCGGACAACACCTTCGTCTT pLKO.1 1071 CDS 100% 1.350 1.890 N GALNS n/a
3 TRCN0000236078 GAGACCAGTCTCAGTTTATTT pLKO_005 2099 3UTR 100% 15.000 10.500 N GALNS n/a
4 TRCN0000236079 CTTCAGACAGGGCATTGATTT pLKO_005 1473 CDS 100% 13.200 9.240 N GALNS n/a
5 TRCN0000051699 CACGGATTTGATGAGTGGTTT pLKO.1 700 CDS 100% 4.950 3.465 N GALNS n/a
6 TRCN0000051698 CGGGAGATTGATGACAGCATT pLKO.1 1015 CDS 100% 4.950 3.465 N GALNS n/a
7 TRCN0000051700 GTTGGCAGATATTATGAAGAA pLKO.1 799 CDS 100% 4.950 3.465 N GALNS n/a
8 TRCN0000051702 CGTGTGCAACTGGGCGGTCAT pLKO.1 1701 CDS 100% 0.000 0.000 N GALNS n/a
9 TRCN0000236076 GGAGATGGTTGGCAGATATTA pLKO_005 792 CDS 100% 15.000 9.000 N GALNS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00612 pDONR223 100% 93.7% 90.2% None (many diffs) n/a
2 ccsbBroad304_00612 pLX_304 0% 93.7% 90.2% V5 (many diffs) n/a
3 TRCN0000468878 AAGAAAGTACTACATAAAATAACC pLX_317 29.1% 93.7% 90.2% V5 (many diffs) n/a
Download CSV