Transcript: Human NM_001323624.1

Homo sapiens G protein nucleolar 2 (GNL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
GNL2 (29889)
Length:
2217
CDS:
528..2174

Additional Resources:

NCBI RefSeq record:
NM_001323624.1
NBCI Gene record:
GNL2 (29889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293696 GAACAGGAACATTCAAATAAA pLKO_005 1974 CDS 100% 15.000 10.500 N GNL2 n/a
2 TRCN0000293756 TTCAGCTTCTGCGGCAGTTTG pLKO_005 862 CDS 100% 10.800 7.560 N GNL2 n/a
3 TRCN0000293755 TTCCATGCAAGCCTTACTAAC pLKO_005 819 CDS 100% 10.800 7.560 N GNL2 n/a
4 TRCN0000047471 GTGGGTAAGATGGTCCTCAAT pLKO.1 1305 CDS 100% 4.950 3.465 N GNL2 n/a
5 TRCN0000047469 GCCTGAATATGTATAGGCAAA pLKO.1 282 5UTR 100% 4.050 2.835 N GNL2 n/a
6 TRCN0000047468 GCCGTTATTAAAGCACTGGAT pLKO.1 1761 CDS 100% 2.640 1.848 N GNL2 n/a
7 TRCN0000286317 GCCGTTATTAAAGCACTGGAT pLKO_005 1761 CDS 100% 2.640 1.848 N GNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03098 pDONR223 100% 74.6% 74.1% None (many diffs) n/a
2 ccsbBroad304_03098 pLX_304 0% 74.6% 74.1% V5 (many diffs) n/a
3 TRCN0000481021 CTGTCAGCAAGAATCATGGTGATC pLX_317 20.4% 74.6% 74.1% V5 (many diffs) n/a
4 ccsbBroadEn_08132 pDONR223 100% 74.5% 74% None (many diffs) n/a
5 ccsbBroad304_08132 pLX_304 0% 74.5% 74% V5 (many diffs) n/a
6 TRCN0000466706 ACCCTTCTGGGCTTCCTGTGATGA pLX_317 18.3% 74.5% 74% V5 (many diffs) n/a
Download CSV