Transcript: Human NM_001323625.2

Homo sapiens acid phosphatase 6, lysophosphatidic (ACP6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ACP6 (51205)
Length:
2497
CDS:
477..1688

Additional Resources:

NCBI RefSeq record:
NM_001323625.2
NBCI Gene record:
ACP6 (51205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381309 TGACCTGACCATGGAACTTTA pLKO_005 1547 CDS 100% 13.200 18.480 N ACP6 n/a
2 TRCN0000052700 GCAGATTCAGAAGTCTTGTAT pLKO.1 1062 CDS 100% 5.625 3.938 N ACP6 n/a
3 TRCN0000289209 GCAGATTCAGAAGTCTTGTAT pLKO_005 1062 CDS 100% 5.625 3.938 N ACP6 n/a
4 TRCN0000052698 GCCATGTCAGTTTATACCTTA pLKO.1 2356 3UTR 100% 4.950 3.465 N ACP6 n/a
5 TRCN0000289154 GCCATGTCAGTTTATACCTTA pLKO_005 2356 3UTR 100% 4.950 3.465 N ACP6 n/a
6 TRCN0000052702 CAGTAGTGATAAAGTGGACTT pLKO.1 1202 CDS 100% 4.050 2.835 N ACP6 n/a
7 TRCN0000289120 CAGTAGTGATAAAGTGGACTT pLKO_005 1202 CDS 100% 4.050 2.835 N ACP6 n/a
8 TRCN0000052701 GTTTGATTACACAGTCACCAA pLKO.1 740 CDS 100% 2.640 1.848 N ACP6 n/a
9 TRCN0000289155 GTTTGATTACACAGTCACCAA pLKO_005 740 CDS 100% 2.640 1.848 N ACP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08251 pDONR223 100% 92% 87.6% None (many diffs) n/a
2 ccsbBroad304_08251 pLX_304 0% 92% 87.6% V5 (many diffs) n/a
3 TRCN0000468307 AAGTCTTAGTTGTGGCACTTCCGG pLX_317 33.8% 92% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_08252 pDONR223 100% 91.9% 87.4% None (many diffs) n/a
5 ccsbBroad304_08252 pLX_304 0% 91.9% 87.4% V5 (many diffs) n/a
6 TRCN0000468907 AGTCCGTCTCTTATGATACCTACT pLX_317 27.6% 91.9% 87.4% V5 (many diffs) n/a
Download CSV