Transcript: Human NM_001324031.2

Homo sapiens semaphorin 4B (SEMA4B), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SEMA4B (10509)
Length:
3777
CDS:
69..2741

Additional Resources:

NCBI RefSeq record:
NM_001324031.2
NBCI Gene record:
SEMA4B (10509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425318 TGGTGATGTGCACGCTCTTTG pLKO_005 2383 CDS 100% 10.800 15.120 N SEMA4B n/a
2 TRCN0000061194 CGATGATGACAAGATCTACTT pLKO.1 992 CDS 100% 4.950 6.930 N SEMA4B n/a
3 TRCN0000428195 CTCTTCACCTTCCACATTATC pLKO_005 3175 3UTR 100% 13.200 9.240 N SEMA4B n/a
4 TRCN0000412644 GAACAGTGCTCCTTATGTAAA pLKO_005 2985 3UTR 100% 13.200 9.240 N SEMA4B n/a
5 TRCN0000418218 GTGGCAGTGTACCCGTCATTA pLKO_005 2284 CDS 100% 13.200 9.240 N SEMA4B n/a
6 TRCN0000061196 CATGTGTACCTACATCAACAT pLKO.1 695 CDS 100% 4.950 3.465 N SEMA4B n/a
7 TRCN0000061193 CGAAGCTGAACACATCTCCAA pLKO.1 413 CDS 100% 2.640 1.848 N SEMA4B n/a
8 TRCN0000061195 CGGCACCGGAACAGCATGAAA pLKO.1 2442 CDS 100% 1.875 1.313 N SEMA4B n/a
9 TRCN0000061197 CCGCGTGCTGAACTTCCTCAA pLKO.1 1478 CDS 100% 1.350 0.945 N SEMA4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07623 pDONR223 100% 93.9% 93.9% None (many diffs) n/a
2 ccsbBroad304_07623 pLX_304 0% 93.9% 93.9% V5 (many diffs) n/a
3 TRCN0000474968 TACTTTAACCTTTAACACATGCCG pLX_317 22.2% 93.9% 93.9% V5 (many diffs) n/a
4 ccsbBroadEn_07624 pDONR223 100% 93.8% 93.7% None (many diffs) n/a
5 ccsbBroad304_07624 pLX_304 0% 93.8% 93.7% V5 (many diffs) n/a
6 TRCN0000479465 CTCCAGCCTCCAGTGACGGGTATG pLX_317 11% 93.8% 93.7% V5 (many diffs) n/a
7 ccsbBroadEn_15716 pDONR223 0% 53.1% 53.1% None (many diffs) n/a
8 ccsbBroad304_15716 pLX_304 0% 53.1% 53.1% V5 (many diffs) n/a
9 TRCN0000473456 TCGTGGGCCTAATGTCCACTAGTG pLX_317 22% 53.1% 53.1% V5 (many diffs) n/a
Download CSV