Transcript: Human NM_001324124.3

Homo sapiens cytoplasmic FMR1 interacting protein 1 (CYFIP1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CYFIP1 (23191)
Length:
6736
CDS:
89..3760

Additional Resources:

NCBI RefSeq record:
NM_001324124.3
NBCI Gene record:
CYFIP1 (23191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164545 CGCACGTGATGGAAGTGTATT pLKO.1 1215 CDS 100% 13.200 18.480 N CYFIP1 n/a
2 TRCN0000188878 GCAGCCTAACAGAGTGGAAAT pLKO.1 298 CDS 100% 10.800 7.560 N CYFIP1 n/a
3 TRCN0000338602 GCAGCCTAACAGAGTGGAAAT pLKO_005 298 CDS 100% 10.800 7.560 N CYFIP1 n/a
4 TRCN0000098316 CCCACCATATTGGACATAGAA pLKO.1 1757 CDS 100% 5.625 3.938 N Cyfip1 n/a
5 TRCN0000186347 CCATCTACTTAAAGTCCAGAA pLKO.1 3541 CDS 100% 4.050 2.835 N CYFIP1 n/a
6 TRCN0000338603 CCATCTACTTAAAGTCCAGAA pLKO_005 3541 CDS 100% 4.050 2.835 N CYFIP1 n/a
7 TRCN0000161982 GCAGACCAGATATTTGCCTAT pLKO.1 2117 CDS 100% 4.050 2.835 N CYFIP1 n/a
8 TRCN0000350983 GCAGACCAGATATTTGCCTAT pLKO_005 2117 CDS 100% 4.050 2.835 N CYFIP1 n/a
9 TRCN0000163972 CTCAGCAAATTGCCATCGCAA pLKO.1 3204 CDS 100% 2.640 1.848 N CYFIP1 n/a
10 TRCN0000158469 CCAGATTCTCAATGATGAGAT pLKO.1 3631 CDS 100% 0.495 0.347 N CYFIP1 n/a
11 TRCN0000338604 CCAGATTCTCAATGATGAGAT pLKO_005 3631 CDS 100% 0.495 0.347 N CYFIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324124.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07850 pDONR223 100% 97.5% 97.6% None 116_117ins90;828G>A n/a
2 ccsbBroad304_07850 pLX_304 0% 97.5% 97.6% V5 116_117ins90;828G>A n/a
3 TRCN0000478326 GAACCCGCTGGAAAAGCGTACGGA pLX_317 7.4% 97.5% 97.6% V5 116_117ins90;828G>A n/a
Download CSV