Transcript: Human NM_001324215.2

Homo sapiens ELAV like RNA binding protein 4 (ELAVL4), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ELAVL4 (1996)
Length:
3779
CDS:
109..1185

Additional Resources:

NCBI RefSeq record:
NM_001324215.2
NBCI Gene record:
ELAVL4 (1996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418500 AGCCAGTGTTGCCTAAGTATT pLKO_005 1317 3UTR 100% 13.200 18.480 N ELAVL4 n/a
2 TRCN0000038706 CCGACATCCAATACAAGCAAT pLKO.1 169 CDS 100% 4.950 6.930 N ELAVL4 n/a
3 TRCN0000038704 CCGTATCATCACCTCACGAAT pLKO.1 591 CDS 100% 4.950 6.930 N ELAVL4 n/a
4 TRCN0000038707 CGTAAAGGTGATTCGTGACTT pLKO.1 1017 CDS 100% 4.950 6.930 N ELAVL4 n/a
5 TRCN0000112098 GTGTTGCAAGTTTCCTTTAAA pLKO.1 1141 CDS 100% 15.000 10.500 N Elavl4 n/a
6 TRCN0000429224 TTACCCAGCCAGCTAACTTTA pLKO_005 1496 3UTR 100% 13.200 9.240 N ELAVL4 n/a
7 TRCN0000429481 GAACTGGGTGGTGCATCTTTG pLKO_005 923 CDS 100% 10.800 7.560 N ELAVL4 n/a
8 TRCN0000038708 GTTTAGGGTATGGATTTGTTA pLKO.1 380 CDS 100% 5.625 3.938 N ELAVL4 n/a
9 TRCN0000038705 CCCAATTACCATTGATGGAAT pLKO.1 864 CDS 100% 4.950 3.465 N ELAVL4 n/a
10 TRCN0000112099 CCGCTTTGATAAGAGGATTGA pLKO.1 657 CDS 100% 4.950 2.970 N Elavl4 n/a
11 TRCN0000112096 CCAACCTCATCGTCAACTATT pLKO.1 260 CDS 100% 13.200 6.600 Y Elavl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06154 pDONR223 100% 94.6% 94% None (many diffs) n/a
2 ccsbBroad304_06154 pLX_304 0% 94.6% 94% V5 (many diffs) n/a
3 TRCN0000470496 AAACATACCGACTTGACATAGCAG pLX_317 45.3% 94.6% 94% V5 (many diffs) n/a
Download CSV