Transcript: Human NM_001324250.2

Homo sapiens zinc finger protein 37A (ZNF37A), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF37A (7587)
Length:
9038
CDS:
646..2331

Additional Resources:

NCBI RefSeq record:
NM_001324250.2
NBCI Gene record:
ZNF37A (7587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304235 CAGAGTCATCTGGAATTAATT pLKO_005 871 CDS 100% 15.000 10.500 N ZNF37A n/a
2 TRCN0000304170 CCCAATGCCACTCTTCATTAA pLKO_005 2573 3UTR 100% 13.200 9.240 N ZNF37A n/a
3 TRCN0000108201 CGTCAGAAGTCAGCCCTAATT pLKO.1 2074 CDS 100% 13.200 9.240 N ZNF37A n/a
4 TRCN0000331697 CGTCAGAAGTCAGCCCTAATT pLKO_005 2074 CDS 100% 13.200 9.240 N ZNF37A n/a
5 TRCN0000304171 AGTTAAATCTCACTCCAATTC pLKO_005 1325 CDS 100% 10.800 7.560 N ZNF37A n/a
6 TRCN0000108202 TCTCATTTAAGTCAGTCCTTA pLKO.1 1736 CDS 100% 4.950 3.465 N ZNF37A n/a
7 TRCN0000108204 GAACCCACTCAATTAACAATA pLKO.1 1349 CDS 100% 13.200 7.920 N ZNF37A n/a
8 TRCN0000300964 GAACCCACTCAATTAACAATA pLKO_005 1349 CDS 100% 13.200 7.920 N ZNF37A n/a
9 TRCN0000108200 GCCAAGTTATTAGTTCCTAAA pLKO.1 5323 3UTR 100% 10.800 6.480 N ZNF37A n/a
10 TRCN0000108203 TGAGTTTAACAAAGGTGGAAA pLKO.1 927 CDS 100% 4.950 2.475 Y ZNF37A n/a
11 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 3728 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
12 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 3735 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
13 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 3734 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07156 pDONR223 100% 99.9% 100% None 1440A>G n/a
2 ccsbBroad304_07156 pLX_304 0% 99.9% 100% V5 1440A>G n/a
3 TRCN0000475629 CCGCTCCCTGAAGGTCCCTATCCC pLX_317 15.9% 99.9% 100% V5 1440A>G n/a
Download CSV