Transcript: Human NM_001324286.2

Homo sapiens signal transducing adaptor molecule (STAM), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
STAM (8027)
Length:
3599
CDS:
224..1555

Additional Resources:

NCBI RefSeq record:
NM_001324286.2
NBCI Gene record:
STAM (8027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226465 ACAAAGTTGTTAGCGTATTTA pLKO_005 2067 3UTR 100% 15.000 21.000 N STAM n/a
2 TRCN0000226464 CATCAAGGCATAGGGTTATTT pLKO_005 689 CDS 100% 15.000 21.000 N STAM n/a
3 TRCN0000218424 TGAACGAAGATCCGATGTATT pLKO_005 1056 CDS 100% 13.200 18.480 N STAM n/a
4 TRCN0000004064 CCAGGTGCCAAACTATAACTT pLKO.1 1450 CDS 100% 5.625 3.938 N STAM n/a
5 TRCN0000175140 GCTGGAAGATATTGATAGAAA pLKO.1 970 CDS 100% 5.625 3.938 N Stam n/a
6 TRCN0000004065 CTGCTAAATGCCACTGACAAT pLKO.1 1585 3UTR 100% 4.950 3.465 N STAM n/a
7 TRCN0000004062 CCCTTTCCACTTTGTATCCAA pLKO.1 510 CDS 100% 3.000 2.100 N STAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11252 pDONR223 100% 56.6% 54.8% None (many diffs) n/a
2 ccsbBroad304_11252 pLX_304 0% 56.6% 54.8% V5 (many diffs) n/a
3 TRCN0000469240 GAGCGTTCGCCGCTAGAAAAAAAA pLX_317 30.1% 56.6% 54.8% V5 (many diffs) n/a
Download CSV