Transcript: Human NM_001324288.2

Homo sapiens signal transducing adaptor molecule (STAM), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
STAM (8027)
Length:
3999
CDS:
717..1955

Additional Resources:

NCBI RefSeq record:
NM_001324288.2
NBCI Gene record:
STAM (8027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226465 ACAAAGTTGTTAGCGTATTTA pLKO_005 2467 3UTR 100% 15.000 21.000 N STAM n/a
2 TRCN0000226464 CATCAAGGCATAGGGTTATTT pLKO_005 1089 CDS 100% 15.000 21.000 N STAM n/a
3 TRCN0000226462 AGGATTGTCTTCGGTCTATTA pLKO_005 320 5UTR 100% 13.200 18.480 N STAM n/a
4 TRCN0000218424 TGAACGAAGATCCGATGTATT pLKO_005 1456 CDS 100% 13.200 18.480 N STAM n/a
5 TRCN0000004061 CTAGTGAAGTAAGCAACGTAT pLKO.1 458 5UTR 100% 0.000 0.000 N STAM n/a
6 TRCN0000226463 GTGAAGTAAGCAACGTATTAA pLKO_005 461 5UTR 100% 15.000 10.500 N STAM n/a
7 TRCN0000004064 CCAGGTGCCAAACTATAACTT pLKO.1 1850 CDS 100% 5.625 3.938 N STAM n/a
8 TRCN0000175140 GCTGGAAGATATTGATAGAAA pLKO.1 1370 CDS 100% 5.625 3.938 N Stam n/a
9 TRCN0000004065 CTGCTAAATGCCACTGACAAT pLKO.1 1985 3UTR 100% 4.950 3.465 N STAM n/a
10 TRCN0000004063 TGTGTATCAAACTGTGGCAAA pLKO.1 403 5UTR 100% 4.050 2.835 N STAM n/a
11 TRCN0000004062 CCCTTTCCACTTTGTATCCAA pLKO.1 910 CDS 100% 3.000 2.100 N STAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11252 pDONR223 100% 48.9% 46.2% None (many diffs) n/a
2 ccsbBroad304_11252 pLX_304 0% 48.9% 46.2% V5 (many diffs) n/a
3 TRCN0000469240 GAGCGTTCGCCGCTAGAAAAAAAA pLX_317 30.1% 48.9% 46.2% V5 (many diffs) n/a
Download CSV