Transcript: Human NM_001324327.2

Homo sapiens p21 (RAC1) activated kinase 3 (PAK3), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PAK3 (5063)
Length:
9023
CDS:
430..2109

Additional Resources:

NCBI RefSeq record:
NM_001324327.2
NBCI Gene record:
PAK3 (5063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148181 CTTACTTACAGTGAATTCCC pXPR_003 CGG 268 16% 5 0.6987 PAK3 PAK3 75679
2 BRDN0001148041 GGTCTTGGTGCGATAACTGG pXPR_003 TGG 612 36% 9 0.1639 PAK3 PAK3 75678
3 BRDN0001148485 TTTGCAGATAAAAGTGCACA pXPR_003 TGG 485 29% 8 -1.0073 PAK3 PAK3 75680
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199531 GTCAGCTGTATTCCGTGACTT pLKO.1 1938 CDS 100% 4.950 6.930 N PAK3 n/a
2 TRCN0000199628 GCACGATTACTCCAAACTTCC pLKO.1 769 CDS 100% 4.050 5.670 N PAK3 n/a
3 TRCN0000003243 CAACCCAAGAAGGAATTAATT pLKO.1 1384 CDS 100% 15.000 10.500 N PAK3 n/a
4 TRCN0000195548 CAGACTTTGAGCATACGATTC pLKO.1 650 CDS 100% 6.000 4.200 N PAK3 n/a
5 TRCN0000003245 CCAAACTTCCAACATAACAAA pLKO.1 780 CDS 100% 5.625 3.938 N PAK3 n/a
6 TRCN0000195142 CTTGGAATTATGGCAATTGAA pLKO.1 1816 CDS 100% 5.625 3.938 N PAK3 n/a
7 TRCN0000003246 CTAAGAAGCATTGTGAGTGTT pLKO.1 1237 CDS 100% 4.950 3.465 N PAK3 n/a
8 TRCN0000025158 GCAAAGTAAACGAAGCACTAT pLKO.1 1719 CDS 100% 4.950 3.465 N Pak3 n/a
9 TRCN0000350661 GCAAAGTAAACGAAGCACTAT pLKO_005 1719 CDS 100% 4.950 3.465 N Pak3 n/a
10 TRCN0000003242 GAACAGAAGAAGAACCCACAA pLKO.1 805 CDS 100% 4.050 2.835 N PAK3 n/a
11 TRCN0000003244 GTGGGTGATGAACTATGGGTA pLKO.1 1474 CDS 100% 2.640 1.848 N PAK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487953 TCCTACCTGGTACCGTAATCTGCC pLX_317 18.5% 97.3% 97.3% V5 277_321del n/a
2 TRCN0000488201 GCCAGAGTTGTTACTGTGATCTCG pLX_317 18.7% 97.3% 97.3% V5 (not translated due to prior stop codon) 277_321del n/a
3 ccsbBroadEn_14728 pDONR223 99.6% 95.5% 43.4% None (many diffs) n/a
4 ccsbBroad304_14728 pLX_304 0% 95.5% 43.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV