Transcript: Human NM_001324331.2

Homo sapiens p21 (RAC1) activated kinase 3 (PAK3), transcript variant 21, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PAK3 (5063)
Length:
8978
CDS:
430..2064

Additional Resources:

NCBI RefSeq record:
NM_001324331.2
NBCI Gene record:
PAK3 (5063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199531 GTCAGCTGTATTCCGTGACTT pLKO.1 1893 CDS 100% 4.950 6.930 N PAK3 n/a
2 TRCN0000199628 GCACGATTACTCCAAACTTCC pLKO.1 724 CDS 100% 4.050 5.670 N PAK3 n/a
3 TRCN0000003243 CAACCCAAGAAGGAATTAATT pLKO.1 1339 CDS 100% 15.000 10.500 N PAK3 n/a
4 TRCN0000195548 CAGACTTTGAGCATACGATTC pLKO.1 650 CDS 100% 6.000 4.200 N PAK3 n/a
5 TRCN0000003245 CCAAACTTCCAACATAACAAA pLKO.1 735 CDS 100% 5.625 3.938 N PAK3 n/a
6 TRCN0000195142 CTTGGAATTATGGCAATTGAA pLKO.1 1771 CDS 100% 5.625 3.938 N PAK3 n/a
7 TRCN0000003246 CTAAGAAGCATTGTGAGTGTT pLKO.1 1192 CDS 100% 4.950 3.465 N PAK3 n/a
8 TRCN0000025158 GCAAAGTAAACGAAGCACTAT pLKO.1 1674 CDS 100% 4.950 3.465 N Pak3 n/a
9 TRCN0000350661 GCAAAGTAAACGAAGCACTAT pLKO_005 1674 CDS 100% 4.950 3.465 N Pak3 n/a
10 TRCN0000003242 GAACAGAAGAAGAACCCACAA pLKO.1 760 CDS 100% 4.050 2.835 N PAK3 n/a
11 TRCN0000003244 GTGGGTGATGAACTATGGGTA pLKO.1 1429 CDS 100% 2.640 1.848 N PAK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487953 TCCTACCTGGTACCGTAATCTGCC pLX_317 18.5% 100% 100% V5 n/a
2 TRCN0000488201 GCCAGAGTTGTTACTGTGATCTCG pLX_317 18.7% 100% 100% V5 (not translated due to prior stop codon) n/a
3 ccsbBroadEn_14728 pDONR223 99.6% 98.2% 44.6% None (many diffs) n/a
4 ccsbBroad304_14728 pLX_304 0% 98.2% 44.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV