Transcript: Human NM_001324373.2

Homo sapiens acyl-CoA synthetase medium chain family member 5 (ACSM5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ACSM5 (54988)
Length:
1117
CDS:
148..774

Additional Resources:

NCBI RefSeq record:
NM_001324373.2
NBCI Gene record:
ACSM5 (54988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157455 GACAGAGAAGGACCTCAAGTA pLKO.1 594 CDS 100% 4.950 3.465 N ACSM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12130 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12130 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473174 GTCGGAGTGGGTCTACGAGCGTTG pLX_317 62.7% 100% 100% V5 n/a
4 ccsbBroadEn_15878 pDONR223 0% 99.8% 99.5% None 424A>G n/a
5 ccsbBroad304_15878 pLX_304 0% 99.8% 99.5% V5 424A>G n/a
6 TRCN0000469072 GGCTTATCCCGCCATCTCTTTTCG pLX_317 70.8% 99.8% 99.5% V5 424A>G n/a
7 ccsbBroadEn_08442 pDONR223 100% 35.9% 35.9% None 624_625ins1113 n/a
8 ccsbBroad304_08442 pLX_304 0% 35.9% 35.9% V5 624_625ins1113 n/a
9 TRCN0000469405 CTCCTATAGCGATTTTCTCCCCGC pLX_317 22.4% 35.9% 35.9% V5 624_625ins1113 n/a
Download CSV