Transcript: Human NM_001324465.2

Homo sapiens elongator acetyltransferase complex subunit 2 (ELP2), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ELP2 (55250)
Length:
8300
CDS:
36..2384

Additional Resources:

NCBI RefSeq record:
NM_001324465.2
NBCI Gene record:
ELP2 (55250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129206 CCCTGCATTGGGATTATCAAA pLKO.1 1400 CDS 100% 5.625 7.875 N ELP2 n/a
2 TRCN0000435254 GAGTCCTGACAGCAAGTATTT pLKO_005 1934 CDS 100% 13.200 10.560 N ELP2 n/a
3 TRCN0000129180 CCAAAGTCATACACTGGCTAT pLKO.1 2228 CDS 100% 4.050 3.240 N ELP2 n/a
4 TRCN0000130402 GCTGTCTTTCAGGGAGATATA pLKO.1 1425 CDS 100% 13.200 9.240 N ELP2 n/a
5 TRCN0000430043 GGACATCAGATCCTGCATTAT pLKO_005 394 CDS 100% 13.200 9.240 N ELP2 n/a
6 TRCN0000428895 TTATGCGGTGCATGCTGTTTA pLKO_005 365 CDS 100% 13.200 9.240 N ELP2 n/a
7 TRCN0000129382 GATACGTGGTTGCAGTAGGAT pLKO.1 2113 CDS 100% 3.000 2.100 N ELP2 n/a
8 TRCN0000129112 CCAGAGATTGTCATTTCAGGA pLKO.1 1041 CDS 100% 2.640 1.848 N ELP2 n/a
9 TRCN0000129363 GCCAAAGTCATACACTGGCTA pLKO.1 2227 CDS 100% 2.640 1.848 N ELP2 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 6981 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 6981 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 6981 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2693 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2693 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12192 pDONR223 100% 86% 85.9% None (many diffs) n/a
2 ccsbBroad304_12192 pLX_304 0% 86% 85.9% V5 (many diffs) n/a
3 TRCN0000466320 CGGCAACGTTTCCTCTTTTCCCAT pLX_317 15.1% 86% 85.9% V5 (many diffs) n/a
Download CSV