Transcript: Human NM_001326358.2

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 18 (ADAMTS18), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ADAMTS18 (170692)
Length:
5837
CDS:
860..4009

Additional Resources:

NCBI RefSeq record:
NM_001326358.2
NBCI Gene record:
ADAMTS18 (170692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371177 GAGCGAAGATGCCGTAATATT pLKO_005 3620 CDS 100% 15.000 21.000 N ADAMTS18 n/a
2 TRCN0000377638 GGATCCATCCTGCGTAGATTT pLKO_005 3895 CDS 100% 13.200 18.480 N ADAMTS18 n/a
3 TRCN0000046867 GCCATTTGCTTGCGAGATCAA pLKO.1 3035 CDS 100% 4.950 6.930 N ADAMTS18 n/a
4 TRCN0000046863 GCCGCCAGTATCTCAAGAAAT pLKO.1 1776 CDS 100% 13.200 9.240 N ADAMTS18 n/a
5 TRCN0000046864 GCCATCTTACTAACAGGATTT pLKO.1 1499 CDS 100% 10.800 7.560 N ADAMTS18 n/a
6 TRCN0000046865 CCAGCGGATTAAATGATGATT pLKO.1 500 5UTR 100% 5.625 3.938 N ADAMTS18 n/a
7 TRCN0000046866 CCAGCATAAAGCAAATGAATA pLKO.1 2614 CDS 100% 13.200 7.920 N ADAMTS18 n/a
8 TRCN0000031643 CCACGTTTGAATACCAGCGTT pLKO.1 2793 CDS 100% 2.640 3.696 N Adamts18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09783 pDONR223 100% 85.6% 76.9% None (many diffs) n/a
2 ccsbBroad304_09783 pLX_304 0% 85.6% 76.9% V5 (many diffs) n/a
3 TRCN0000470889 TGCTCACCGTACAGGGACGCAGAC pLX_317 13.6% 85.6% 76.9% V5 (many diffs) n/a
Download CSV