Transcript: Human NM_001326542.2

Homo sapiens Sp4 transcription factor (SP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SP4 (6671)
Length:
6072
CDS:
216..2519

Additional Resources:

NCBI RefSeq record:
NM_001326542.2
NBCI Gene record:
SP4 (6671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311011 TGTAACAACCCTACCAATTAA pLKO_005 923 CDS 100% 15.000 21.000 N Sp4 n/a
2 TRCN0000425976 TGTAACAACCCTACCAATTAA pLKO_005 923 CDS 100% 15.000 21.000 N SP4 n/a
3 TRCN0000421768 CAGACAGTTCCGGTCCAAATT pLKO_005 843 CDS 100% 13.200 18.480 N SP4 n/a
4 TRCN0000436110 GTTCAACTTCAAGCAGTAAAT pLKO_005 1494 CDS 100% 13.200 18.480 N SP4 n/a
5 TRCN0000419469 ACCACTGCTTCAACGTCTTTG pLKO_005 1140 CDS 100% 10.800 15.120 N SP4 n/a
6 TRCN0000020511 CCCGTTACAATCACTAGTGTT pLKO.1 1818 CDS 100% 0.000 0.000 N SP4 n/a
7 TRCN0000435080 CTTATCAGGGCTCCAACTTTA pLKO_005 1527 CDS 100% 13.200 10.560 N SP4 n/a
8 TRCN0000412698 TGCCTGTTCCTGTCCTAATTG pLKO_005 2033 CDS 100% 13.200 10.560 N SP4 n/a
9 TRCN0000431990 GAATCTTCCCATCTCTTAATA pLKO_005 2786 3UTR 100% 15.000 10.500 N SP4 n/a
10 TRCN0000423687 GTATTTCCTCCATACTATAAG pLKO_005 2726 3UTR 100% 13.200 9.240 N SP4 n/a
11 TRCN0000426367 ACTACTTCTGCCAGTACTATG pLKO_005 1086 CDS 100% 10.800 7.560 N SP4 n/a
12 TRCN0000020510 GCAGGTAATAATCAAGCTATA pLKO.1 765 CDS 100% 10.800 7.560 N SP4 n/a
13 TRCN0000020509 CCTCTAGTGCTGCACTTGTTT pLKO.1 2540 3UTR 100% 5.625 3.938 N SP4 n/a
14 TRCN0000020512 GCAACAGATCATTCAGGCTAT pLKO.1 1403 CDS 100% 4.050 2.835 N SP4 n/a
15 TRCN0000020513 GCAGTAATAACGGGAGTGCAT pLKO.1 550 CDS 100% 2.640 1.848 N SP4 n/a
16 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3962 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
17 TRCN0000086294 CCAGCAGTAATAACGGGAGTT pLKO.1 547 CDS 100% 4.050 2.835 N Sp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01583 pDONR223 100% 97.8% 97.8% None 0_1ins51 n/a
2 ccsbBroad304_01583 pLX_304 0% 97.8% 97.8% V5 0_1ins51 n/a
3 TRCN0000470949 CAAAATCACACAATAGCTGTAACT pLX_317 21.1% 97.8% 97.8% V5 0_1ins51 n/a
Download CSV