Transcript: Human NM_001326580.2

Homo sapiens syntaxin 7 (STX7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
STX7 (8417)
Length:
1248
CDS:
169..888

Additional Resources:

NCBI RefSeq record:
NM_001326580.2
NBCI Gene record:
STX7 (8417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065053 CCAGAGGATCTCTTCTAACAT pLKO.1 213 CDS 100% 5.625 7.875 N STX7 n/a
2 TRCN0000299051 CCAGAGGATCTCTTCTAACAT pLKO_005 213 CDS 100% 5.625 7.875 N STX7 n/a
3 TRCN0000065055 CGTCTTATTCATGAGAGAGAA pLKO.1 664 CDS 100% 4.950 6.930 N STX7 n/a
4 TRCN0000298981 CGTCTTATTCATGAGAGAGAA pLKO_005 664 CDS 100% 4.950 6.930 N STX7 n/a
5 TRCN0000065057 GTTCACAACATCACTGACAAA pLKO.1 456 CDS 100% 4.950 3.465 N STX7 n/a
6 TRCN0000298982 GTTCACAACATCACTGACAAA pLKO_005 456 CDS 100% 4.950 3.465 N STX7 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1132 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01925 pDONR223 100% 89.8% 89.2% None (many diffs) n/a
2 ccsbBroad304_01925 pLX_304 0% 89.8% 89.2% V5 (many diffs) n/a
3 TRCN0000474079 CACCGTCAAGCTCCTCGGATAATC pLX_317 71.3% 89.8% 89.2% V5 (many diffs) n/a
Download CSV