Transcript: Human NM_001329395.2

Homo sapiens vacuole membrane protein 1 (VMP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
VMP1 (81671)
Length:
3725
CDS:
122..1381

Additional Resources:

NCBI RefSeq record:
NM_001329395.2
NBCI Gene record:
VMP1 (81671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338825 GTGCTTATAGCTACGTATTAT pLKO_005 383 CDS 100% 15.000 21.000 N VMP1 n/a
2 TRCN0000135158 CAACAGTATGTGCAACGTATA pLKO.1 419 CDS 100% 10.800 15.120 N VMP1 n/a
3 TRCN0000338886 CAACAGTATGTGCAACGTATA pLKO_005 419 CDS 100% 10.800 15.120 N VMP1 n/a
4 TRCN0000138826 GCAAGCACATAGTGGAGCAAA pLKO.1 1059 CDS 100% 4.950 3.960 N VMP1 n/a
5 TRCN0000135490 GTAGCAATGAACAAGGAACAT pLKO.1 158 CDS 100% 4.950 3.960 N VMP1 n/a
6 TRCN0000138386 CGATGCAATCCACCTTGTGTT pLKO.1 1575 3UTR 100% 4.950 3.465 N VMP1 n/a
7 TRCN0000338887 CGATGCAATCCACCTTGTGTT pLKO_005 1575 3UTR 100% 4.950 3.465 N VMP1 n/a
8 TRCN0000135137 CTCAGTTACATTAGCTGCTTA pLKO.1 550 CDS 100% 4.950 3.465 N VMP1 n/a
9 TRCN0000136659 GAAAGGATACTGGAGAGAGAA pLKO.1 2317 3UTR 100% 4.950 3.465 N VMP1 n/a
10 TRCN0000135938 GCAATGAACAAGGAACATCAT pLKO.1 161 CDS 100% 4.950 3.465 N VMP1 n/a
11 TRCN0000338822 GCAATGAACAAGGAACATCAT pLKO_005 161 CDS 100% 4.950 3.465 N VMP1 n/a
12 TRCN0000136225 GCTTGTCACAAATGATTGCTT pLKO.1 1745 3UTR 100% 3.000 2.100 N VMP1 n/a
13 TRCN0000136327 CTTTATTTGATCTGGCTGGAA pLKO.1 927 CDS 100% 2.640 1.848 N VMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14292 pDONR223 100% 96.8% 96.1% None 974_1012del;1243delG n/a
2 ccsbBroad304_14292 pLX_304 0% 96.8% 96.1% V5 (not translated due to frame shift) 974_1012del;1243delG n/a
3 TRCN0000472825 TAACTTTTCGTTTCAACGCGCCAG pLX_317 36.9% 96.8% 96.1% V5 (not translated due to frame shift) 974_1012del;1243delG n/a
Download CSV