Transcript: Human NM_001329641.2

Homo sapiens spindle apparatus coiled-coil protein 1 (SPDL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SPDL1 (54908)
Length:
2499
CDS:
111..1928

Additional Resources:

NCBI RefSeq record:
NM_001329641.2
NBCI Gene record:
SPDL1 (54908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161394 GTGGATATAACCACCGCTAAA pLKO.1 1482 CDS 100% 10.800 15.120 N SPDL1 n/a
2 TRCN0000164576 CCAGGTTAGCTGCTGAATCAA pLKO.1 1777 CDS 100% 5.625 7.875 N SPDL1 n/a
3 TRCN0000161609 GCTGCACAGTATGGTTTACAA pLKO.1 177 CDS 100% 5.625 7.875 N SPDL1 n/a
4 TRCN0000160944 GCTCGTGTAGCAAATCAAGAT pLKO.1 795 CDS 100% 4.950 6.930 N SPDL1 n/a
5 TRCN0000343263 GCTCGTGTAGCAAATCAAGAT pLKO_005 795 CDS 100% 4.950 6.930 N SPDL1 n/a
6 TRCN0000161014 GCTGCGAATGTGAAGCTATTA pLKO.1 340 CDS 100% 13.200 9.240 N SPDL1 n/a
7 TRCN0000343208 GCTGCGAATGTGAAGCTATTA pLKO_005 340 CDS 100% 13.200 9.240 N SPDL1 n/a
8 TRCN0000135058 CCTTCTGGGTTATTTACTCAT pLKO.1 2013 3UTR 100% 4.950 3.465 N SPDL1 n/a
9 TRCN0000135059 CCAAGTGTTCAGAATTTGCTT pLKO.1 2068 3UTR 100% 3.000 2.100 N SPDL1 n/a
10 TRCN0000159642 GCCATGTATTTGAGAATGCTT pLKO.1 2245 3UTR 100% 3.000 2.100 N SPDL1 n/a
11 TRCN0000161450 CCTTTGACCAAGTGTTCAGAA pLKO.1 2061 3UTR 100% 4.950 2.970 N SPDL1 n/a
12 TRCN0000343264 CCTTTGACCAAGTGTTCAGAA pLKO_005 2061 3UTR 100% 4.950 2.970 N SPDL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08429 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
2 ccsbBroad304_08429 pLX_304 0% 99.7% 99.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469040 TCAATTTCCGCTGGGTTATCTCAT pLX_317 24.2% 99.7% 99.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV