Transcript: Human NM_001330062.1

Homo sapiens phosphatidylinositol-5-phosphate 4-kinase type 2 alpha (PIP4K2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PIP4K2A (5305)
Length:
3628
CDS:
207..1250

Additional Resources:

NCBI RefSeq record:
NM_001330062.1
NBCI Gene record:
PIP4K2A (5305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194807 CATCGACGTCTATGGAATTAA pLKO.1 1034 CDS 100% 15.000 21.000 N PIP4K2A n/a
2 TRCN0000195145 CCAGCATCGTTCTAGCTATTT pLKO.1 1431 3UTR 100% 13.200 18.480 N PIP4K2A n/a
3 TRCN0000356495 TTGGGCATGTACCGGCTTAAT pLKO_005 564 CDS 100% 13.200 18.480 N PIP4K2A n/a
4 TRCN0000356567 ATCCGAACATCGACGTCTATG pLKO_005 1027 CDS 100% 10.800 15.120 N PIP4K2A n/a
5 TRCN0000220609 CCTCGGACAGACATGAACATT pLKO.1 1263 3UTR 100% 5.625 4.500 N PIP4K2A n/a
6 TRCN0000220610 CGGCTTAATGTTGATGGAGTT pLKO.1 576 CDS 100% 4.050 3.240 N PIP4K2A n/a
7 TRCN0000220611 GTGTACTTCATGGCAATTATT pLKO.1 1083 CDS 100% 15.000 10.500 N PIP4K2A n/a
8 TRCN0000356493 ATACATCATCAAGACTATTAC pLKO_005 452 CDS 100% 13.200 9.240 N PIP4K2A n/a
9 TRCN0000194659 CCGAGCCATTTCAAGTTTAAG pLKO.1 282 CDS 100% 13.200 9.240 N PIP4K2A n/a
10 TRCN0000196936 GCCACCGTTTGTCTGTGTATA pLKO.1 631 CDS 100% 13.200 9.240 N PIP4K2A n/a
11 TRCN0000025576 GCCGAGCCATTTCAAGTTTAA pLKO.1 281 CDS 100% 13.200 9.240 N Pip4k2a n/a
12 TRCN0000356569 GTATAGGAAATACGACTTAAA pLKO_005 647 CDS 100% 13.200 9.240 N PIP4K2A n/a
13 TRCN0000196296 GAAGCAAACCTCCTTGTTTAC pLKO.1 1352 3UTR 100% 10.800 7.560 N PIP4K2A n/a
14 TRCN0000195216 CTCAGTGAAGTACTCATCTTG pLKO.1 1328 3UTR 100% 4.950 3.465 N PIP4K2A n/a
15 TRCN0000220612 CCTGAAGAAATACCACCAGTA pLKO.1 503 CDS 100% 4.050 2.835 N PIP4K2A n/a
16 TRCN0000196561 GTTTACATCTTCAGGCCAAGA pLKO.1 1367 3UTR 100% 4.050 2.835 N PIP4K2A n/a
17 TRCN0000010988 CGGGAGAGGTTTGGAATTGAT pLKO.1 333 CDS 100% 5.625 2.813 Y PIP4K2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01207 pDONR223 100% 85.4% 85.4% None 0_1ins177 n/a
2 ccsbBroad304_01207 pLX_304 0% 85.4% 85.4% V5 0_1ins177 n/a
3 TRCN0000475290 TGACTGACATGCAAGACACCTTGC pLX_317 33.1% 85.4% 85.4% V5 0_1ins177 n/a
4 ccsbBroadEn_14766 pDONR223 0% 85.4% 85.4% None 0_1ins177 n/a
5 ccsbBroad304_14766 pLX_304 0% 85.4% 85.4% V5 0_1ins177 n/a
6 TRCN0000471649 CGCTGGAGCCACCTTACCAGTTAT pLX_317 37.3% 85.4% 85.4% V5 0_1ins177 n/a
Download CSV