Transcript: Human NM_001330211.2

Homo sapiens mediator complex subunit 24 (MED24), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MED24 (9862)
Length:
3537
CDS:
86..3112

Additional Resources:

NCBI RefSeq record:
NM_001330211.2
NBCI Gene record:
MED24 (9862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230510 GCGAAGACATTGAGGATTATA pLKO_005 2652 CDS 100% 15.000 21.000 N MED24 n/a
2 TRCN0000230511 ATGCGACTGCTGAGCTCTAAT pLKO_005 2714 CDS 100% 13.200 18.480 N MED24 n/a
3 TRCN0000019649 CCGCGAAGACATTGAGGATTA pLKO.1 2650 CDS 100% 10.800 15.120 N MED24 n/a
4 TRCN0000230512 CAGGATGTCTCCCGGTTTCTT pLKO_005 3273 3UTR 100% 5.625 7.875 N MED24 n/a
5 TRCN0000217980 TTCTGCAACAACCTGATTAAG pLKO_005 2372 CDS 100% 13.200 9.240 N MED24 n/a
6 TRCN0000230509 GCCAGCGTCAACAACCTTATG pLKO_005 1268 CDS 100% 10.800 7.560 N MED24 n/a
7 TRCN0000019651 CCAATGGGCAATCAACATGAA pLKO.1 148 CDS 100% 4.950 3.465 N MED24 n/a
8 TRCN0000019650 CGTCAACAACCTTATGGCTAA pLKO.1 1273 CDS 100% 4.050 2.835 N MED24 n/a
9 TRCN0000019653 CTAGTGCAGATGAAGTGGCAT pLKO.1 1847 CDS 100% 0.000 0.000 N MED24 n/a
10 TRCN0000019652 CACTGTCACAAACATCCTCAA pLKO.1 1387 CDS 100% 4.050 2.430 N MED24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07499 pDONR223 100% 98% 98.1% None 560_616del;1218G>A;2943C>T n/a
2 ccsbBroad304_07499 pLX_304 0% 98% 98.1% V5 560_616del;1218G>A;2943C>T n/a
3 TRCN0000466728 GATGGCTTTCTTTAACAGGCGAGC pLX_317 10.8% 98% 98.1% V5 560_616del;1218G>A;2943C>T n/a
Download CSV