Transcript: Human NM_001330229.2

Homo sapiens proteasome activator subunit 3 (PSME3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
PSME3 (10197)
Length:
3448
CDS:
685..1266

Additional Resources:

NCBI RefSeq record:
NM_001330229.2
NBCI Gene record:
PSME3 (10197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058071 GAGAAATGTAACACGGTCAAA pLKO.1 892 CDS 100% 4.950 6.930 N PSME3 n/a
2 TRCN0000296473 ACACCCAACCTGTCGTAATTT pLKO_005 1484 3UTR 100% 15.000 10.500 N PSME3 n/a
3 TRCN0000296521 ACTGGATGGTCCCACTTATAA pLKO_005 735 CDS 100% 15.000 10.500 N PSME3 n/a
4 TRCN0000066562 AGAGCCAAATTGGTTTCTAAA pLKO.1 1057 CDS 100% 13.200 9.240 N Psme3 n/a
5 TRCN0000335594 AGAGCCAAATTGGTTTCTAAA pLKO_005 1057 CDS 100% 13.200 9.240 N Psme3 n/a
6 TRCN0000066559 GCAGAAGACTTGGTGGCAAAT pLKO.1 577 5UTR 100% 10.800 7.560 N Psme3 n/a
7 TRCN0000335512 GCAGAAGACTTGGTGGCAAAT pLKO_005 577 5UTR 100% 10.800 7.560 N Psme3 n/a
8 TRCN0000058070 CGAAGGTTGGATGAGTGTGAA pLKO.1 760 CDS 100% 4.950 3.465 N PSME3 n/a
9 TRCN0000307160 CGAAGGTTGGATGAGTGTGAA pLKO_005 760 CDS 100% 4.950 3.465 N PSME3 n/a
10 TRCN0000058069 CGTGACAGAGATTGATGAGAA pLKO.1 1116 CDS 100% 4.950 3.465 N PSME3 n/a
11 TRCN0000290094 CGTGACAGAGATTGATGAGAA pLKO_005 1116 CDS 100% 4.950 3.465 N PSME3 n/a
12 TRCN0000058068 GCATCTTATCTGGACCAGATT pLKO.1 1018 CDS 100% 4.950 3.465 N PSME3 n/a
13 TRCN0000290025 GCATCTTATCTGGACCAGATT pLKO_005 1018 CDS 100% 4.950 3.465 N PSME3 n/a
14 TRCN0000058072 GAACCAATCTTAAACATCCAT pLKO.1 640 5UTR 100% 3.000 2.100 N PSME3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02348 pDONR223 100% 75.9% 75.9% None 0_1ins183 n/a
2 ccsbBroad304_02348 pLX_304 0% 75.9% 75.9% V5 0_1ins183 n/a
Download CSV