Transcript: Mouse NM_001330291.1

Mus musculus flavin containing monooxygenase 1 (Fmo1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Fmo1 (14261)
Length:
2232
CDS:
207..1805

Additional Resources:

NCBI RefSeq record:
NM_001330291.1
NBCI Gene record:
Fmo1 (14261)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001330291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076365 CCTCGATGAATCCGTAGTGAA pLKO.1 1217 CDS 100% 4.950 6.930 N Fmo1 n/a
2 TRCN0000076367 CTCGATGAATCCGTAGTGAAA pLKO.1 1218 CDS 100% 4.950 6.930 N Fmo1 n/a
3 TRCN0000076364 CCCATTGACATCATCGTCTTT pLKO.1 1167 CDS 100% 4.950 3.960 N Fmo1 n/a
4 TRCN0000076363 CCAGAGAATACTCTGAGCATT pLKO.1 2068 3UTR 100% 0.495 0.347 N Fmo1 n/a
5 TRCN0000076366 CCAGAAGACTATCCAAACTTT pLKO.1 429 CDS 100% 5.625 3.375 N Fmo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00581 pDONR223 100% 84.9% 83.2% None (many diffs) n/a
2 ccsbBroad304_00581 pLX_304 0% 84.9% 83.2% V5 (many diffs) n/a
3 TRCN0000479381 CTAGAGCTACACCTGGAATCCAAT pLX_317 11.6% 84.9% 83.2% V5 (many diffs) n/a
Download CSV