Transcript: Human NM_001330522.1

Homo sapiens family with sequence similarity 124 member A (FAM124A), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
FAM124A (220108)
Length:
2426
CDS:
169..1074

Additional Resources:

NCBI RefSeq record:
NM_001330522.1
NBCI Gene record:
FAM124A (220108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172871 GAAAGCGGACTTCTGCATCTT pLKO.1 771 CDS 100% 4.950 3.960 N FAM124A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16126 pDONR223 0% 95.2% 94.6% None 852_853insTC;863_903del n/a
2 ccsbBroad304_16126 pLX_304 0% 95.2% 94.6% V5 852_853insTC;863_903del n/a
3 ccsbBroadEn_13412 pDONR223 100% 53.3% 52% None (many diffs) n/a
4 ccsbBroad304_13412 pLX_304 0% 53.3% 52% V5 (many diffs) n/a
5 TRCN0000472164 CTGCAGGGATGTGGGGGCACAATT pLX_317 27.2% 53.3% 52% V5 (many diffs) n/a
Download CSV