Transcript: Human NM_001330537.1

Homo sapiens syndecan binding protein (SDCBP), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SDCBP (6386)
Length:
3930
CDS:
1845..2801

Additional Resources:

NCBI RefSeq record:
NM_001330537.1
NBCI Gene record:
SDCBP (6386)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293202 AGCAAGACCTTCCAGTATAAA pLKO_005 2153 CDS 100% 15.000 21.000 N SDCBP n/a
2 TRCN0000293260 TATAGCATACTTGCATCTTTA pLKO_005 3182 3UTR 100% 13.200 18.480 N SDCBP n/a
3 TRCN0000029154 CCTATCCCTCACGATGGAAAT pLKO.1 2019 CDS 100% 10.800 15.120 N SDCBP n/a
4 TRCN0000293258 CCTATCCCTCACGATGGAAAT pLKO_005 2019 CDS 100% 10.800 15.120 N SDCBP n/a
5 TRCN0000029158 CGGAACATAACATCTGTGAAA pLKO.1 2605 CDS 100% 4.950 6.930 N SDCBP n/a
6 TRCN0000029157 GTACTTCAGATCAATGGTGAA pLKO.1 2376 CDS 100% 4.050 5.670 N SDCBP n/a
7 TRCN0000293199 GTACTTCAGATCAATGGTGAA pLKO_005 2376 CDS 100% 4.050 5.670 N SDCBP n/a
8 TRCN0000029155 GAGAAGATTACCATGACCATT pLKO.1 2454 CDS 100% 4.950 3.465 N SDCBP n/a
9 TRCN0000293259 GAGAAGATTACCATGACCATT pLKO_005 2454 CDS 100% 4.950 3.465 N SDCBP n/a
10 TRCN0000029156 GCAGAAATTAAGCAAGGGATT pLKO.1 2220 CDS 100% 4.050 2.835 N SDCBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01512 pDONR223 100% 93.1% 93.1% None 1_63del;302_303insGCA n/a
2 ccsbBroad304_01512 pLX_304 0% 93.1% 93.1% V5 1_63del;302_303insGCA n/a
3 TRCN0000470095 CAATAATGTCCATTTTTAATCTCT pLX_317 49.1% 93.1% 93.1% V5 1_63del;302_303insGCA n/a
Download CSV