Transcript: Human NM_001330738.1

Homo sapiens zinc finger protein 518A (ZNF518A), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
ZNF518A (9849)
Length:
8511
CDS:
1073..5524

Additional Resources:

NCBI RefSeq record:
NM_001330738.1
NBCI Gene record:
ZNF518A (9849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148745 CCATGGCGAATTACCTTCATA pLKO.1 1501 CDS 100% 5.625 7.875 N ZNF518A n/a
2 TRCN0000149523 GCGATAATAACACAGCAGCTT pLKO.1 3752 CDS 100% 2.640 3.696 N ZNF518A n/a
3 TRCN0000130912 GCTACCAGTTATTCCTGGAAA pLKO.1 3919 CDS 100% 4.950 3.960 N ZNF518A n/a
4 TRCN0000147461 CAGGAGTAACAACTGAGTTAA pLKO.1 2559 CDS 100% 13.200 9.240 N ZNF518A n/a
5 TRCN0000130471 GCACAGAAGTACCTTGATTTA pLKO.1 5740 3UTR 100% 13.200 9.240 N ZNF518A n/a
6 TRCN0000130887 GCCACCTGAAGTAAACCAATT pLKO.1 3409 CDS 100% 10.800 7.560 N ZNF518A n/a
7 TRCN0000148478 CGGGATTGGAACATGTTAGAA pLKO.1 5501 CDS 100% 5.625 3.938 N ZNF518A n/a
8 TRCN0000150254 GCCATACATAGAATGCTTCAA pLKO.1 7231 3UTR 100% 4.950 3.465 N ZNF518A n/a
9 TRCN0000131006 CCATCAGAACTTTGCGGCTTT pLKO.1 5040 CDS 100% 4.050 2.835 N ZNF518A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11424 pDONR223 100% 64.2% 64.2% None 1_1590del n/a
2 ccsbBroad304_11424 pLX_304 0% 64.2% 64.2% V5 1_1590del n/a
3 TRCN0000470037 TCTCCCATAGCAGTGCAGTTAGAC pLX_317 17.6% 64.2% 64.2% V5 1_1590del n/a
Download CSV